Macaca_mulatta Locus Mono:51:SNORD19
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:51:SNORD19
Macaca_mulatta
Mono:51:SNORD19
7
SNORD19
1001..1074
2074
AAAGAGCGAGATTTGGGGACAGGGAAATAGCTTGTTTCAGAACTTCAGTAAAACTGCAT
TTAGAACAGGAAAACTTTGAAATGGGGGCAGGGTGGGGGGAATTTATTCTACTTTTAACC
ATCAAGTAAGCATGACAGCCTCTGTTACTTACGCTCACAAATACTTGACTTTCCCCTATG
GCCAGCTACCTGGAAGGAAATATTTCCAGCCCCCTTGAAGTTAAAACTGTAGCCATGTGA
CCAGTTCTGTCCAGTGAAATATGAGTAGACGTGATTGTGTCACCTGAAACTGAAGCATTT
TATTGACATTATTTGAACCACCCGCAGCTCCTCCTTCTGTCATGGTCATGAGGAGGGCAA
CGTTCTAGATGAAGAGATTAGTATCGGGGGTCTGCTTAAAGGACCACTGCCCCAGTAATT
TGCACAAATGCAAATTTGCTCAGAATGATTCTGCATGGGAAGGAAATAAACATTTACTGT
GTTGAGTCACTAAAATTCTGAGGTTGTTTACATAGAACATTATTGCCTTTTCCTGGCTAA
TATATGGACCTAGTCATATCTTTTACACATATAAAAAGTCAAGTCTCATCTTTTCATGGC
TAAGCATAGTTAGCAAAAAAGGCCCTTATATTTACCTAGTTCATCACCCTTTGATGGCTG
TTAATCCAACTTTCCAAGGTCATATATATTTACTGGAAACAGAATAGAAAATAATTTAGC
TAATCCTAATCCAAAGCCCTTGGTATAGCATCTAGTCTGTATTTCAAGATGAAATTATAG
CAGTTGCTGTTTCCATCCTTGGGTAATCTTATCCTTTCCATTATTTTAAACTGCTCTTCT
ATGTAGAAGACAACAAAATTATCACCTCTAAGAATTTCTCCTTAAATTCCTCAAGGTATC
TCACACTCAACCACCGAAACAACATCACACTCACCTTCTAGGTGCCATGATTTATGCATC
ACTTGACTCTGGACAATGTCAAATATATTTCTTTGTAGTAGGGCTCAATAAATGTTTCAA
TTTAATTGAATGAAAAATTAATTTCTATTTTTTTCACCTTGATTCATTTGCACTGCATCT
TTCTATCTGATCAGAAATCATCTGATTTCATTGCACTGGACTTAAGAACCTCAAAGTCAT
CTTTGATTTCTTCTTCTTCCTCAACACTAAAGGCCAAATGACTGCCAAGACCTTTCATGA
TATTTTTACTACATCTCCAAAAATCTATGTTCTTCTTTTCTATTATTTCAGGCCTTCATC
TCTCAAATGCAACATATCTTTTCCATTTTAATTTCTGATTATTCCAATTTTTGTATTGGT
TCTGGAACTAAATCATATTTTCTTCCTTTTATTTTATTTATGTATCATTCTTAAAATTTT
CCTTCTGGTCAGAAAGAGCAATTTTTGTAGAAAGGAAGAGAGAGTTTGCAGTGTATAGGT
TAAGGAGAGAGGTTTTAGAGCCCAACTCATCTGGGTTTGCATCTTGAAATCTGACTTTTC
AGTTGAATGGCTGCATATCCTTGATCTCTTCAGTTAGAATTTCTGTACTTCACTTTAGTC
ATGTAGACAACTGTGGCCTGATCTTGGCACTTACCATTTTCATGATTTTCGAAATCTCCT
AATAAAACCTACTTATACACAAATACAATTACAGACACCCCCCTCACACACACACACACA
CATACATTGGTAAGCAATGTGAAAATTATGAAAGATTTCTTAGAGAAGGTGAAGGAAAGG
CCCTACAACGCATAGCTCCCAGCAGAACCCTTTTTTCTCTACCACTGTCTACTCACTTCT
ATTTGTTCTCTTATTTAGTCTCTTCTGGGCTTTTTCCTTCTGGTATCTCAAATTTCTTGT
GATTTTCCTTATGCAGAGCAAATTAGCAACCATAATTTTCTTGTGGTCTCACCCTTACTT
TTAAACAGCTTCTAGAAGTGTATGTTCCAAACATATGCATTGTTTACCCTATAGTGATTT
TCATTTAAGGTGTTCTCTCCATCTTTAACCTGGGATGATATCACTGTCCATATGTTTTGT
GAGTATCCAATAGTTTAATGTATGTAAAAGCTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved