Macaca_mulatta Locus Mono:291:SNORA9
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:291:SNORA9
Macaca_mulatta
Mono:291:SNORA9
6
SNORA9
1001..1131
2131
AATAAAGAGCCTAAAAAACCCCACATATGTACAGAAATTTAATATATGATAGAAATGGT
ATTGACAATAAGTGGGGAAAGGATAGACTCTTAAATAAATGAGACTGGGACAATTGGTAA
TCCATATAGAAAAAGAGGAACTAAACTCTTACCTCATACCAAACACAAAAAATAATTTCG
TATGTATTATGGACTTAAATGCAAATGGAAAACTTTAAGACTTTTAGAAGATATCTTTGG
CCGGGCACAGTGGCTCACGCCTGTAATCCCAGCACTTTAGGAGGCCAAGGCCGGCAGATC
ACCCAAGGTCACGAGTTTGAAAGAGCCCAGAGGATAGTTTTATTTGTATTTGAACTTTAT
CTAACTGGAAACATACAGTAAATACGTAAATGGGGCCAAGCGTGGTGGCTAATGCCTATA
ATCCCAACACTTTGGGAAGCTGAGGTGAGCAGATCACCTGAGGTTGGTAGTTCAAGACCA
GCCTGACCAGCATGGAGAAACTCCGTCTTTACTAAAAATACAAAATTATCCAGGTGTGGT
GGCACACGCCTATAATCCCAGCTACTGGGGAGGTTGAGGCAGGAGAATTGCTTGAACCCA
GGAGGCAGAGTTTGCGGTGAGTCAAGATCGTGCTATTGCACTCTAGCCTGGGCAACAAGA
GCAGAACTCCATCTCAAAAAACAAAAAACAAAACAAAAAAAAACCCCTAACCTTTAGTGA
TAGATGTCAGATACTGGTTTCCTTTGATGGGAGGCACTGGCTGAAAGGAAGATAAGGGGT
GATGTAATTATTTCATATCTTGCTTTGGGGGGTGGTTACATGGGTATATTTAATTGCTAC
AATTGATAAAGCTAAATAGTTAGGGCCCCCTTGCATTTTATTTTATATAAGTTTACGTCT
TTAAAGGAAAACATATTGTTAATAAAATGAATAGACAGACACACCACGAATTGTGAGATA
GTATTTGCAGTGCATATGTGTGACAAAAGACTTGTATCCCGTAGCAAGCCTCCAGCATGC
TTGGGTCTGTGGTGACCCTATGCATTCCTTCAGTGCTTGCTAGAACAGTTTTGAAACGGT
TTGAGACCTTGCCCTTCTATCCAGAGCAAGGTTATAAAAATTTCAGACAATGACTTGCTC
CCTCCTGGATCTGGTGTGCTGGGCCTTGTATAGATCTGCACCATCTAATGTGGCAGCCAC
TTGGCATACATGATTAAATTAAATTTGGAGTTCTATTACATTTTCACACTAGCCACATTT
CAGGTGGCCAGTAGCCACAGGTGGCCAGTGGCTACCATATTGGACTGCACAGATTAGAGG
GCATTTCTGTCGCTGTGGAAGTTGTTTTGGACAATTCTGGTGTGAAAGGTGAATGGAATC
CTGAGTGTTTGCTATGCTCCAGACTCAGTACAAATTTTATTTTATTACACACTTAAAGCA
AAAGCCTTATGAAAGTTGAGGATGAAGCCAAGAGAGGTGGTAAGTGTAGGAGCTGAAACA
GTGGAGAGGAATAACAGGGAAGAGTCCTGCCCTGAGAGATTCATGGAACAGGATATTTAC
AAGGCAAAGCAAAGAGAACCAGAGTCTCAGTTCTGCAGAGGGGCTGAATGCCCCGGGAGC
TAGTGGAGGGTGAGGTCAATGTGTACTCATCTTAAAGGAAAAACTCATGGAAGAGGAAGG
TGCTAATGTTGTTGAACACCTATTTTGTGCCAACCCTCTTAATTCTTGTTTTAAATCTTT
GAGGTATCACCATGAGGTCGTTTTTAAGTTCAGTACAGATGAGGAGCCCAAGGTCAGAAT
TATGTGTCTAGGGTTGCCCAGCCACAAACCGGCAGATCAGAGTTTGATGCCAGGCCTCTC
TAACCCTGCAGCCTGAGTGGAATATAGAAGCTGGTGGGAAGTTTGGGTGGGAAGGAGATG
GATGCCTTAAAGTTATTGTCTTGGTGTTAGGTGTGTTAAAGGATTGACTGGGATGGGAAA
AGTGTTGCTGGCTTGGGCATAGCACAAGCAGCACAGCTCCTGTGTTCCTTTGGGTGGTGG
GGTCACCTCTCTTAAAGGTAGAGGCTTCTAGCTGATTCTGTCTTTTCAGGCCAGGAACAG
TTGCTGAACACCCCAGGCCTGCTGAGGTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved