Macaca_mulatta Locus Mono:142:SNORA76
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:142:SNORA76
Macaca_mulatta
Mono:142:SNORA76
2
SNORA76
1001..1133
2133
AAACAGGGTCCTGTTCTGTTGCCCAGGCTAAAGTGCAGTGGCTCAATCTCAGCTCACTG
CAACCTCTGCTTCCTGGGCTCAAGGGATCCTCCCACTTTAGCCTCCCAAGTAGTCCCTCC
CAGCTGGGACTACAGGTGCCATCATGCCCAGCTACTTTTTGTAGAGACGGGCTTTCACCA
TGTGGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGCAATCTACCCACTTTGGCCTCTAA
AAGTGCTGGGATTACAGGTGTGAGGCACTGCACCTGGCATAAACAAAATTCTTTTAAAAA
ATACTTCTTCTGCATAAAAATAAAAATCCCCTTCTTGTTTATGATATTTTAAAAATGCAT
TTTACCACTTTGTTTCATTTTGCAAGTTTTATCTCTTCAACTAGTCTCTAAGTTTACTGA
GTGAAAGGAACCATTCTGTATACACAGCAAATATTCAATAAGCCCTTGTTGATAAAGGAA
TTAAAGGGAGAAGATTAGCACTCTGAATTTTAATAATAGTGGAAAGACATGTGATAAGAC
AGGTAAGGTATAGTCCCAGTAATCACCTCCATATTTAAATATGAGGCCAGGTGCGGTGGC
TCACGCCTATAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACCTGAGGTCAGGA
GTTCAAGACCAGTCTGGCCAACATGGTCAAACCCCGTCCCTACTAAAAATACAAAAATTC
ACTGGGTGTGGTGGCGGGCGCCTGTAATCCCAGCTACTCAGGAGGTTGAGGCAGGGAGAA
TTGCTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCCGAGATCATGCCATTGCACTCCAGC
CTGGGCGAGAGCGCGAGACTCCATCTTAAAAAATAATTTAAAAAAATAAAAATAAATAAA
TGTGAGATACATCCAGAGGTAAAATCACATGGGTAACATCCTTTATCCCCCCAAGTCATA
CTATGTTATAGTTGGTTTTTTTTTTTTTAAACTCTAGTTACGCGCTGTCTTTGAGCCCCC
GCCGAGCCTCCTCGTGGCGCCGGGGGTCAATCTGCAGCGCTAGAGCATGTGCTTGCGCAT
AACTGGGGCCGCTTGGCCCCCCGCGGGCGGCCCTTTTAACCGCGAGCGACAATTAGTAAC
CTGACTGTCCGGCTGCTAGGCTGGGCAATTTTCCAGGGATTTTGCCACGACAGGCCTCAA
CCCGTAATACCAAGGCTGGAATGGCGTGTGAGGGGGACGGTGTCTGACGGGGATACGCGG
ACTGCTGCGTAGTGAGTGCCCCTCTGTGCTCCCATGCGTTCCCCAGCCCTCCCCGAGTGC
ATCGCGCGCGTTGTGCCTTTGCCATGAGTTCGACATAAGTCCCAAGCTGTCGTGTCTGCC
ATCAGACGCGCAGGTTTAGTTGAAGGCAGCTTGGAATGGCGTCTGCAGGGCTGCTGTGTA
CTTGACATAAACGGATTCAGTGTGGAACTGCATGAGTTAACTCCTGACTAAAAGGGTAAT
CGACCTGTTTACAAACAACCACCATGCAGGAGTATGTGTGACAAGCATGGGACTAAAGCT
TCGGGTTAGGTTAATCTGTCACTCCTAAACAGTTAAAAATTATAGGGCGGTTGTGAAGAT
GAATTAGGTTTTATATATAGTTGGGGACAACATAGACACCTAGTTACAGTCCAGATTCTA
TGGTTGGTAAAAGATCTTACACAAGGGCTCCAGTGAAATGTGCATCAGTTCTGAGTACGA
GGCAGCAGTGGTGGGCAAGGATGCACGTATGCGCTCACTACATGGGCATTCGATGAATGA
ACGTGTCCCGAATGAAGATAACTAGACGATGAAGGGTATAAACTGCAGCCCAGGAGCACC
ACTGCCCTACCCCCTCAGTTATGAACTTTCACTGGATTCTTTAAATGTGGGCTGAAGATA
ATGGCACATAATTTGAAGGGATGTGGTGAGGATGGCTTTGCAGCCTTAGGACTGGGCAGT
GATCCAAACCAGTTAAGTGAAAGCTGCCATTGCCAGGTGAGGGCCCCGGTGCTTGGTACT
CACTTGTGCCCCTATCTGAACAGGATTCAGTAGAAATGACTTAGATGCTTATCTAGTATT
TGACATGAGATATTTATTTTGTGAAACAATGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved