Macaca_mulatta Locus Mono:126:SNORA43
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:126:SNORA43
Macaca_mulatta
Mono:126:SNORA43
2
SNORA43
1001..1116
2116
TTTTTAAATGACGAGTAAGATGCAATGAAATAGTTTTGCTAGAAAAAAAGTCAAAACAA
AACTATTGTAATAACAACATAGTAACTTCTCAATGACACATGAACACATTATTCTTGTAA
AAACAAACTAAATATTACAGTTAAACTGAAGTTCCCTTTGACCACCATCTCCCCAGAGGT
CAATGTTTGACAGAAAATTCTCTAGAATTCCATATTGACTGAAAAATGGTTAATATGAAT
CACTTCTCCCTTTGTTTGACTTTATTACACATCTAATATGTAGTAGGTGCCTGAATGTAG
CCCTGAGGTAAAATTGAGGCTCTGAGAAGCTAAATGACTTGTCCCAGGTTGCAAAGGTAG
GAAGTGGATGAACTGGGATTCGAACTTGGTTTCCCTGACTCTCCATTCTGTCTGCTGTCT
TCTTGTTTTGCTAGGCGACTGTCTCCTGTTCTGTTGGGTTGGTGATTTTAGGGGAAACAG
AAAACCAGTATCCAATCCATTGTGCCTAAAAAGTTACTAAACATTCTTCGTTAAGGGAAA
GAATCATCCGAAAGTTAAAATATTCTGCGATGCTGTTTAATGCTGAACAATACACCCAGC
ACTAGCTCACAGGCATTCTTAGAGAGACACTAGTCTACTGGTAACATAACAAAGAGCCTG
TCAGTACTTTTGTTTTTTAATATAAAATTTCATTTGATAAAGAAAATGCAGTCAAAACGC
ATATTTATTCTCAATAAGGATATCCATTAGAATAAACACTTACATCATCTTCTTTTGGAG
CGTTTATTTTCACTTGATATTCTAGATTAACATTCCTTTGCTCTTGATCAGGATTTGGTT
CCCAACGTAAAAGAACTTGAGCCAAACCAGTAACTTTAATGGTGAAATTGACAGGTGGGA
GAAGTGAAACTGTTGATTCAAAGAATAAAGAAACAGCACAATGTTCAACTGGACATAGGC
AGCACTTTTAAAATTTTTTGAATATTTGTTGCCCTGCAGATGCTGTCCTGGACCTGCGAG
CACCACAGACACAGTTGCTCCTGCCATGCCTGTAACACCGGGGCAAAGAGAAAGTGCCTA
TTTCTACCTGAGTAGCTAGGACTACAGGCGCATGCCACCACGCTGGGCTAATGGGTTTTT
TTTTTTATTTTTTTATTTTTGGTATTTTTAATAGAGACAGGTTTTCACCATGTTGGCTAG
GCTGGTCTCCAACTCCTAACTTCAAATGATCTGCCCGCCTCAGCCTTCCAAAATGCTAGC
AGGCAGGAGCCACCACGCCCAGCCTAGAAAAGGTTTCTTTAAAACTGTTTTTAACATCTT
TTTTTACATTGCCCATGTCCAGGTGTTTACCTATAATACCTATATTTTTATTGAAATATG
AACATGTTACTATATCACTATTCACTATTCACTGTAACTATAATTTTCAAACTGAGAGTC
ATTATCCATTAGCAGTCAATGATAACAATGTATTGGTTTGTGACCATAATTTTTCTTTTA
ATGATGTGGAAGAAAAATAGAATAGAAAATATCAGTGTGCATCAAACATAATAAGAGTTG
TTTCATGAATCTCGTTTCCACTACATAAGGGTAGTTATATATTTGTATGTGTGCTGGTAC
ATAACGTAAAAATGTATTTACCTCTTATTATGAGTCACAGACAAAAATATTTGCAAGCAA
ACTTATTTAAATAGGGCTTTACAGAAAGAAAATGTTTCTTCCCCCTTCATGAGCCACTCT
CTGACTTTGCTTTCAAAATAAAAGCTTTTGCTTAATTGCAAAATCAATATCTGTTTATTG
AAGAAATTTTGGAAAACACAGATAAGCAAAAAGAAGAAGATAAATTTTTTAAAATAATTG
TACCACCAAGAATGGCATTAACATATGATATATTCGTTATTTTTTTCTTGGGTGTATATT
TATGCAATTTTTAATTTTTTTACTACATTTAGGGCAGTATTGTGTACACAATTACAAAAC
CTTCTTTTATTCATTTACTAAGTTATCAGGATTTATCCAGGCATCTTAACAGACTTCCCA
CACCTCTACATCCATGTAGAGGTTTTTAGAGCTCTGAGGATTTTTAGAGCTCTGTCTGTA
TTGCACTGTCCATTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved