Macaca_mulatta Locus Mono:225:SNORA73
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:225:SNORA73
Macaca_mulatta
Mono:225:SNORA73
18
SNORA73
1001..1201
2201
GCAAATATTTATTATTTCAAACAAAACACCGAGTTTCCATTACTTTTGCATGGCAAAGA
AGTGGAATTATTAATCTCAGAGGAGATAGCTTTTTGTTCAGGAAAATATTCTAATGCACT
TTTTTTTTTTTTTGTAAATGATGCCCCTCTTGTCTTAAAAGATAGGATTAAAAAAAGAGA
GAGAGCTAAACTGCACTACATAAAAAATTAACTGGAATTTGGGAACTGGTCACTGATGCC
TCATTGGTGGTTGGAGAGGGCTGAGCAACTTGGCAAGAGGCTGGCAAGAAGCCTAGAAAG
AAAAGACAGCCATGCAGACGTCCAGGCCGAGTGGATAGCTGAGGGGCTTTTAAGAGTAGT
GGTGATTAATATTCAGTTGTCAATGTTTCCTATTCTGAGTTGTGCTGAAACCATTCATTT
CTATCTTTAAAGCTTTAGTTAAGATCTGCCTAGAGATGTGTTGGGTGTTGGCAGAGAGTG
GAGCAGTACTGAGCCTGGGTCAAAGCGGCGTAGAAAGAGGATGTTGGTTATGGGAGCTGA
GACAGCTAATTTAGGGCAGGCTGCCCAATGACCAACCCTGGAGAACATCAGCCTTCCCTT
GGGAATCCTCAAAGGTTTCAGGAAGAGTGTGGAGGACATGGATAGAGGCTTGAGCCATTT
CCTTTGGGTAGTAAAGAAAAGGGAAATATCAGGCTCCTGACGTGTAGGTAACTTTTAGCC
ATGCTGAGACAGCTGGATGAACAGAACAAGGACAACATATCTATCCATCCGTCAATTGAT
CCAATTATTCGTCATTCAGTAAGTACCAAGAACCTATTATACGTGAATCACTACATTACA
AGAGACATAGTTTCTTTTTTTGTGTGCAGATTTTAATTTTAATAATTAACGTATACACAA
AGCACATTAAAGAAATAAAACCCAAAGCTTCCAGGATGAGCTTGACTTTCTATGGGCCTC
GGAGAATGACTTGCATTTGAATAAGAATCAAAGGAGACATTCCAACGTGGATACCCTGGG
AAGTCACTCTCCCTAGGCTCTGTCTAAATGGCATAGGGGAGCATATGGTCTCATCCCAGG
ATGTACAGTCCTTTGCCACAAGTTAGAGATGAAGCTGGGCCTGGTATATGCACCTGAATA
TTCCTACAGCTTCTGAGTCCTGTGGACAATGACAGAGGAGACAAACCACGCAAGAAATGT
GTCTAGTATAAAACAAAATTTAAAAGAAAGAATTAAAGGAGGGAAGAATAACATTCATAG
CAACTCTTGATATTTAGATACTAATTTGTAATTTATCATGAAATTGCATGTATAATATCT
GATCTGTCATCACAACTGCTCTTTGAAGCAGGTATTATTATTCCCATCTCTCAGAAGACA
AAACTGAAGATTATAGTTTGAGTAATATGTTCCAAAAACATAAAATTAGACCATGTGAGT
GACTCAATTGTCAGAGTAATTGTTATTAGTTTTCTCTCAGATCCAAAAATATTCCCTGAC
TTGTTCATCATTTTAATAGTTTATATTAAAAGTGCAGGACATATAATGAAATTTAAACTA
ATGAAAGGTAGAAATAAGGAAAGATTACTGATTAAATCATTCATTCTTCATCTGAATATC
CAATTCCCCATTTTATATGATGCAATTCTCAAAAATGTTACTGTCATGTCATTTTTCTGG
GATGCATCACATAAGTGAGAAGGTACTTAACAGAGTATTTGGGTGTTGCTAAATGCATCT
ATTGCATACCACCTCTGCTTATTCCTATCCTAACATTATGAACAGTACTAAAGAAATACA
AACTACAGTCTCTGCCCCAAAGAAACTTCTCATCCTCTACATAGACGTTTTCCCCTTTCA
TGAAAGAACTATGGTGACTTTAACTTCCACCTAAGAGCTCAAACATGGAAACATTTTACC
AAGTTAAAAATAAGCAATTTCTAACATTATGTTAATTACACCAGGATAAGTTATCAAGAA
AAAAAGCAGTTGGTGTAAGCATTTTCTTTCCTTACTCCCATTTTGAGCAGAAGTTAGCAT
TGTATCTCCAAATGTCCAAGTTATCCTTATTCCCATGTCTGTAGGGGAAATGGAAATTTC
CTTTCATGACTTTATCCTCCTCATCCCACTCTCCTTTGGACCTTGAGTGTCATTAAGTTG
GGTAAGGAGAGGCAGAACGTTGGCGATTTGGGGATGAAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved