Macaca_mulatta Locus Mono:217:SNORD55
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:217:SNORD55
Macaca_mulatta
Mono:217:SNORD55
15
SNORD55
1001..1079
2079
AAATGATGAGAACACATGGACACATAGTGGGGAACAAGTCACACTTGGACCTATTGGAG
AATGGAGGGTATGAGGAAATAGAGGATCAGGAAAAATAACTAATGAATACTAGGCTTAAT
ACCAGTGTGATGAAATAATCTGTACAACAAACCCCCGTGATACAGGTTTACCTGTGTAAC
AAACCACGTGTACTTCTGAACTTAAAAGTAAAAAATACAAGGATTTATAATAAATATTTA
ACACAAAAAAGATTTTTAAAAATGGGTGAAATGCCCCAATCAAGAGGCACATAGTGGTAA
ATTGGAGTAGGAACCAAGACTCATTGGTATGGTGTCTTCAAGAGACCCATCTCACACGCA
GTGAGACCCATAGGCCCAAAATAAAGGGCCAGAGAAAAGTCTACCAAGCAGACAGAAAAC
AGAAAAATCCAAATTTCAGACAAAACACACTTTAAACCAACAAAGGTTAAAAAAAGATAT
CACATAAGGGTAAAGGCTTCAATTCAACAAGAAGACCTAACTAATCTAAATATATGTGCG
CCCAACAGAAGAGCATCCAGATTCATAAAGCAAGTTTTTAGAGACCTATGAGGCTTAGAT
AACCACATAATAATAGTGAGAGACTTCAGCACCACACTGACAGTATTAGATCATCAAGGC
AGAAAATTAACAAGGATATTCAGGACCTGAACACAGCACTGGACCAAATGTACCTGATGG
ACGTCTCCATCCAAAAGCAACAGATATACATTCTTCTCACTGCCACATGGTACATACTCT
AAAATCAATGACATAATTGGACACAAAACATTCCTCAGCAAATGCTGTATAATGAGTACT
AGGCTCATTATAATAACCACCCTCTCAGACCACACTGCAATCAAATTAGAAAACAAGACT
AAGAAATCCACTTAAAACCATATATTTAAATGGAAATAGAATAACCTACTCCTGAATGAC
TTTTGGGTAAATAGTAAAATTAAGGCAGAAACCAAGTTCTTTGAAACTATTGAGAACAAA
GATGCAACATACCACTCGAGTGTGCAGTGGGGAAGCCAACCTTGGAGAGCTGAGCATGTG
AGAAAAAAAAAAAAAAAGAAGCAACATACCAGAATCTCTGTGACACAGCTAAGGCAGTGT
TAAGCAGGCAATTTATAGCACTAAATGCTCACATCAAAAGTTAGAAGTACCTCAATTTAA
CAACCTGACATCACAACCAAAAGGACTAGAGAACCAATAGCACACAAACCCCAAAGTTAG
CAAATGACAAGAAATACTGAAAGTCAGAGCTGAACTGAGATTGAGACATGAAAAAACATT
CAAAAGATCAATGAATTTAGGAGTAGGTTTTTGAAAAAAAATTACTAAAATAGGTAGATT
GGTAGTTAGACTTAATAAAGAAGAAAAACTAGAAGATCCAAATAAACAGAAATGACAAAG
AGGATATTACTGCTGACCCTATAGAAATACAGATAACCATGAGAGAAGATTATGAACACT
TCTATGCACGTAAACTAGAAAATCTCAAAGAAATGGATAAATTCCTGGAGACATACATCC
TCCCAATATTGAGCCAAGAAGAAATTGAATCGCAGAACAGAACAATAATGAACTCCAAAA
TTGAATCAGTAATAAGTAGCCTACCAACCAAACAGAACTAGAGCCAAATTCTACCATATG
TACAAAGAAGAGCTAGTACCATTCCTACGGAAACTATTCCAAAATTTGAGGAGGGACTCC
TCCCTAACTCATCCTATGAGGCCAGCATCATTCTGATAACAAAACCTGGCAGAGACATGA
AAACAACAACAAAAAAACTTCAAGCCAATATCCTTGATGAATATCAATGCAAAAATCTTC
AACAAAATACTGGTAAACCAAATCTAGCAGCACATCAAAAAGCTTATCCACCACAGTCAA
GTAGGCTTTATCCCTGGTATACAAGTTGGTTCAACAAACCCAAGGCAATAAATGTGATTC
ATCACATAAGCAGAACAAAAGACAAAAACCATATGATTATCTCAATAGATACAGAAAAGG
CTTTTGATAAAATTCAAAACCCCTTCATGTTAAAATATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved