Macaca_mulatta Locus Mono:61:SNORD113
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:61:SNORD113
Macaca_mulatta
Mono:61:SNORD113
7
SNORD113
1001..1072
2072
GATGTTAGTTTTATTCAGAATTTTTGAACAGTTTCTTTGGATTCTCAGCTATGGATTGT
AAGGGAATGAATGAAGAAGTTTATGTCACAATAAGTTAAAAGAAGACAAATGACAGACCA
GTGATGGTCATAAATTATGAAGCAAGTATTAGGATAAAGTCATTTCTATACTGCTGATGT
CCATATAAAGGTTATAATGTCTGGACCCCTAACTGCTTAATGTTCACAGATGGGTTCATG
TTATATTCAGTTTTGGATGCTGGTAGATTTATCCTTGTTAATTTTCTTTAAAAAGATAGA
TATAAGATTAAATTAGCCTATTACAAATTAAACAGTAAATAAGCAAATAGATGAATACAT
AAAGAGGGTCAAGAAGGATTTGTCAATTAAATAACATTTTATTTTATTTTAAGAATAAAA
TAAAACTTAAAAAAAAGAATGAGCATTGGTGAAAATGTACCCTGAAACAAAATTTAAGAT
CGATATAATTCTGAACAAGTCGGTTCTGCGAAAAAGTGGATGGAAGAAGATATTTCATTC
AGTTTCAATTGTTTAGTATTTCACTTTTTCACTACTCTTAATTTACACATTCTGCCATTG
ATAAAGATTTAGGTTTCTAAGCTATGGCAGAGAAAACACAAGGAAGGAAAAAAATGTTGT
CAGTGAAGGAAAACATGATGTTCCTTTATGTTCTTTGTTAAATATTTAAAATTTGAAAAT
AGTTGAGGAAAGGCTAGAGAAAGAGGGCCCTGCCTGGGCCATGTTGAGTGTGAGACTGCA
TAAGGATTTTGGTTGGTCCATACGTGTAACAGTGAGATCCTCTGTAGAAGGAGATTTGGT
GGATTAGCTCTTGGAGAAATTAGCCTACATATATCAGTTATAACATTCACATATCTTATT
CTTGCTTTGTTGTGATTCATGAATATTGATTAAGTAATTTTTAGTCAATTAATGAACTAA
ATCAACAAACAACTGTATAAATAAATAAAAAGTCTCAAAACTAAACCAATGATAAGTACT
CTGGGGTGCTTGAATCAAGGATTTTGATTAAACTATATGACTCTGAGGTTCATTGTAAAA
ACAAGTCTAGTTTACTGCCTCAGTGGGACATGAGCTTGTAGCTGCAGTGAGGAATATAAG
CATCTCGTGCTTAGGATTTTGCAGATCTGATATGAATCCTACTATTAGTAGTAAATCAGT
GCATGAGTAAATAAAGACACATACCAATGAATTCAGCCAAAGAGGGCTGGATATGCACCA
ATTATGAGAGTATGTAATGAGATATAAATTATTATTAAATATTTCTGAGAAGCTGAGTTC
TAATAAGTAAATAGTTCAAGGCTGTTACCATATTGGTTAGGAACATATGGGCAGATGTAT
GTTTCTGGGTTGCCAGCTGTTAATTTTGTTCCGTATTTTAATATGAAAAGGGAAAAGAAG
GGAACAGAAATAATTGCTTACAGAACTACCTAATTGAAAGATCAAGCAGGCACCAACTGT
TGAGCTTATGGGCAGATGTTAGTCTTATTTAGAGCTGTTGTTCAGGGTATGTAGGTTAAC
AAATTTTGATGTTATTATTCTAAGCATATGAAGGAAGGGATTATTTATTTATTTGCTTAT
TTTTTATTGACAGAATTTTTTTATTAACTGTAGCATCAAGAATAATACTTCCCTCATAGC
AATGACAAAATAAAACTATAATAATAAAATAATAAAAAATAATACAACTGTTAGTAATAT
AGCTAACAATAATTGTTTACTATATATTAACTATTGTGCAATTTTTAAAAATTTTCTATT
TTTATAGGTTTTGGGGGAATAGGTAATTTTTGATTACATGGGTAAGTTCTTTAGTGGTGA
CGGTGCATCTGTCACCTGAGCAGTGTACACTGTACCCAATGTGTAGTCTTTTATTCCTCA
TCCCCTACCAGCCTTCCCCTTGAGTCCCCAAAGTTCATTATGTCATTATTATGCCTTTGC
ATCCTCATAGCTTAGCTTGCACTTACAAGTAAGAACATATGATGTTTGGTTTTATTCCTA
AGTTAATTCACTGAGAATAATGGTCTTCAACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved