Macaca_mulatta Locus Mono:167:SNORA26
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:167:SNORA26
Macaca_mulatta
Mono:167:SNORA26
13
SNORA26
1001..1114
2114
TGTTCTGCCCTTGCCTGGCACACTGACCTCCTTGAAGGTCCTGTGTCCTTAGTACCTCA
GTACCTTCCCTTCTCATTTTTCTCTGCTTGGAGGCACTCCTACTTCTTTCTTTTTTTGAG
ACAGGGTCTCATGCTGTTGCCCAGGCTGGAGTGCAGTGTTGTGATCACGGTTCACTGCAG
CCTCCACGCTCTGGGCTCAAGGGATCCTCCCACCTCAGCCTACTGAGTAGCTGGGACTAC
ATGCATGCACCACTATGCTTGGCTAATTTTTTTTTTTTGTAAAGATAAGGTCTTACTAAG
TTGCCTAAGCTGGTCTTGAACTCCTGGGCTCAAGCAATCCACCTGCCTTGGCCTCCCAAA
GTGCTGGGATTCCAGGCGTGAGCCACTGTGCCCGGGCCTTCCTTTGTATTTTGTACCTGT
TATTACATGTTTCTCCAGTTACTTTAACTATTTAACATCTGTCTCTCCCACTGGCCCCTG
AGCATCTTGAGGGTAGGAATTATGGATTATTCATGCCTATATCCCCAAATGTATCACGTG
GTAGGTGCTCTATAAACATTTGTAGAATTGAATCAAATGGAACATGTGGGGTGTACACTT
GTGCAAACAGATTGAGCTTCTTTTCTGATAATTTCATTTTGGTGTAAGTTTGCTTTCAGT
TTAAGTAGTCAAAACATTTGGATAGCTATTCTTTTTTTTTTTTTTTTTTTTTTTTGATAA
GTATTCTTGAGTGGACTAAAAATAGCTTTTAATTGATTTCTAGTGCCGATGCTGCAAAAC
TGGAAATCTAAAAGATTTTATCCTTTTATTAGAGTCTGAAGAAGAAAAGAACAAGGGAGG
GGAAATGGTTTTAACATTTTATTTGCCCCCTTTCCTGTGCCTTTTTTTTTTTTTTTTTTT
TTTGAGACGTAGGCTTTGTCACCCGGGCTGTAGTGCAATGGCGCGATCTCGGATCACTGC
AACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTTCCTGTGCCTAAGGTTAACACAG
TGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGTCTCCATAAAACCCAAAGACTCTAT
GAACCCCTCTCTGGATCCTGTCTGGAGTCACAGCTGGGAAAAAAAAAAAAAAACACACAT
TTATCTGCTGGAATAAAGAAATTTAGAAGAAGCAGAAAGGAAACATGATTTTCAGATCTA
GTTTCTCGTTCTTCTGAAAGGAGGAATTTAAACTTGAGGGAGGCTAATTTATTTCCTCTT
TTTACTTTGGGTTTCGTAACTCAGCAATCTTCCCTGAGGCCCCGGGTGAGAACAGTGAGC
TAGCTATGAAGGCAGAAATAAGTAACTAAAGACCTTAGATGGTTAATATTAACGTCCTTT
GCTTTTGTGAATAAACCATATCACCTGGAATTAATAGGTGAAACGTAGAGAACTATTAAC
TAAACCAGGGATTGGCAACCTTTTTCTGTAAGGGCCAGATGGTGACTATTTCTCAGCCAT
AGTGATGCAAAATCAGCCAGAGAAACATGCAAACAAATGGGTATGTAGCTGTGTTGCAAT
AAAACTTTATTTGCAGCAACAGTTGGAAATCAAATTTGGCTTGCTGGCTACAGATTGCTG
ACCCCTGAATGCAACACTCCATTTTCAGGTCTAAGTATTCCCATTCTCTTAAACACACCA
TCTTAGCTCAGGATGTTCTAACAGAATACCACAGACTGGATGGCTTAAACAATAAACATC
TCTTTCTCACAGTTCTGGAAGCTGGGAAGTCTAAGATCAAGGCACCAATAGATCCAGTGT
CCTGCGAGGGCTGTCTTCCTGGTTTGCAGACAGCCTTCTTGCTGTGTCCTCGCATGATGC
AGAGAGAAGAAAGGGGCAAGCGCTCAGGTCTCTTCTTATATGGACACTAATCCCAGTCAT
GAAGGCTCCACCTCATGACCTAATTACTTCCCAAGGACCCCACCTCCTAATACCAACACA
CTGGGGTTTAGGATTTCAACCTGTGAATTTTGGAGGAACACAAACCTTTAGTCCATAACA
CACAGCATGCTTATATAAAAGGAAGAGATGTCCACCAAAGTTGTAAGGTCCATATGGCAC
AGGGACCAAATTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved