Macaca_mulatta Locus Mono:182:SNORD89
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:182:SNORD89
Macaca_mulatta
Mono:182:SNORD89
13
SNORD89
1001..1114
2114
AAAAAAAAATACCGTGCCAGACCAAGGTAAATTGTTTTTGATCATTACAGAAATGTGAT
TTCTTAATCAGCAGCTGTCAAACATAGTGTTCCTTAATTTAAAAGCTTGAACGCTAAATT
ATAAATTGGAGAGGTTGGAATAATTATGGTCATATATCTAGAAACACAAATCTTTAGTAG
CAAAAAAGAAATTAGCAAGAGAAGAAAACTATTCGGTACTTTGAATGGAGAAAGTTTTCA
TTGATAGAAGTTTAGATGAAAATTAACATGAGAAAGAAGTGACAGGCCAAGTGTGGTGGT
TCACGCTTTTAACACAATTTGGGAGGCCAAGATGGGAGGATCTCTTGAGCCCAGGAATTC
AAGACTAGCCTGGGCAACAAGGCAAAACTCATCTCTACTGAAAATTTAAAAAATCAGCTG
GGCATGGTGGCACCCGTCTGTAGTTCCAGCTACTTGGGAAGCTGAGGTGGGAGGATCACT
TGAGCCCAGGAGGTTGAGGCTGCAGTGAGCCGTGATTACACCACTGTATTCCAGCCTGGG
CAAGAGTAAAATCCTGTTAAAGGGGGGAAAAAAAAACAGGAAGGGACAAATATGAGAGTT
TTTGCTAAAGCTTTTAAGTTAAGATGCAGAGAATTGGGGGAATGTATAATAAATCAGATT
TCATTTAGTTATATTATTTACCACATGAATCACTTTCCTCCCAACAGTTGTCGTAAGAGC
CATGTGTTCATGTGTAATGAAGACCAGTATTTAACTGTGGGAACCGTGGGTGGCGTGGCG
AAGGAGACTGTCCGTGACTGTGCCGCTCTCCGCAGCCCTGTCTGCTGTCCTGTTTCCTCG
GCTCCTCGGTGTCTGGACTGGCGTTCTGGGTGTCCCAGCGGAAAACTAAAGGGCCAGAGA
GGTGTAAACACACACACCACTTGGCAGGTAATTTCCCCATGTGCTATCTTTTTAGGGATC
CTGAACACACAGCCTTTCCCAAAAGACTGCTCCCTCCAGCTACTGAGGAATGATGACAAG
AAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCTCTGGGCACACGATGACAA
AATTTCCTGAAGCGAACCACTAGTCTGACCTCAGTAGCAGGATTGGAAGCTTCATGCCAT
GGGAGTGGTCAAGAAAGGCATCCCAAAGAGAACTGAACTATTAAAAAAAAAAAAATAGAC
CTTTAGGAATAGGTGATTGTCCCCATATACTGGGGATGAAATACCCAGTGTAACCAAATT
CCCCAGTAAGATCGCTTAGTTTGGCAATAGTCTCGTCTTTTGAGCACACTGAAGTTTATT
TGCTCAATGAAGGCTGAAATTATAAGTCAGTATATATGTATTACTAAGTAGAACTTGAGG
TAATTATATGTTTTAGTCAAAAGCAGTTTCTGTGGGCTTGGTATAAACCCTACTTTGTGA
TTTGCTAAAGCACAGGATGTTGACTCAAACCAAAACTAGTTTTGTAGTTAATATATGTTG
TGTTTCTGTGACTTAATAGTCAACTAGAAAAGCCACCTACGACATTCCCAGCTAATTAAG
TTTTAAAAGTTTTTTTTTAAATACTTGTCACCATATTTTCAAAAATACTAACATTTGGAT
TACTAGTTATAAAAGTGCAATTTCTACTGTGTCATCATCAGCCCCACAGCTGGAGACTTG
CCCTCTTTGTACAGCCAAGTTGTGAAAAAAGTATTTGCACTACATTCATTTAAACATTAG
GGAAAAAAACCAACCCATGCTTTTCTTTGCTGAGTTGTAGGGTTGTAGTATTGGCTAGTG
AGAAGCCTGGGAACACTAGGACTTTGTGTGGGTGACTGCAGGTATCAGATCCAGGATTAT
ACAGGTACTCTTGGAAGTGTCTTGGGGATTTTCCTGGTAAGAACAACAGTGATTGCAAAA
AAAAAAAAAAAAGACAAGATGTAAAGTGAAATCAGTAAAACATCTTAGTAGACAGAGGGT
GCTGACATTTTAACAAATGTGTAAAAAGTTCTTCCTATACATTAACTTTCCAGATACCCT
TAAAATGTTTAAGGAGTATCATTCAAAATACTGTTTGAGAGACATGTGACCATCATTCTC
CAAGGGAATGTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved