Macaca_mulatta Locus Mono:228:SNORA48
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:228:SNORA48
Macaca_mulatta
Mono:228:SNORA48
X
SNORA48
1001..1134
2134
ACCTAGGATGTCCAAGTGTGGAGATGTTAATAAAAGCACTGATTATGAACGAATGGGAA
GAAAAGACAGAAAAAGGAATTCCGATAAGGCTGACCAGAGAGGCTGATTCTAACCTCTGC
CTGCAGGGAAGAGGCAGGAAAAGAAAGTTGTGGAATCTTGTGAGAAATATAATTTGGAGG
ACATGGACTGTGAGTGAGTAAGAGCTTGGAAAGATGTGGAAGCCACTCTGAGCTTGGGAG
AACATGGGGGATATTGTCAGCTTGGAAGGATGGTGGGGGTCCCTGTGAGCTTGAAGGATA
CAGGAGGGCCTGTGAGCCTGGTGTGGTGCAGGTTGTTTGCAGGATGAGATTAGGGACTTT
CTCGTCCTGCTACCTGATAGCCGTTTTCCTCATTTTCTGTTCATATTAGTCCGTTCTCAC
ATTACTGACGGCTGTTGTGATACCTTGATTCTTGTCTACCTAGTTTAAAAGAATTTAAAC
ACAGACACACAGATCAGGAGATGCAGCATAGAGTAAATTATTGTAAAACAAAAAGAGTAT
TTTGCAAGTCAGTGGGAGAATAGAGAGTACACCCTGAGAAAGGAGATTCCGGGCAGGTAG
CTAGTTAGGGTGAGAGAGTATTGATTATTGCTGAAGAAACTCCCTTTATGGGAGTCTTAC
ATGATGACTCATAAGGAGGTGGAAAGAAGTGTTGCTAGTAAGCATGTTCTGGGTGGTCCT
CTGGGTGCACATGCGCAGTAGCCATACATGCTTGTTCATGGACTGCAGGTCTCATTAGCA
TCTTATATCTCTACCCGCAGGTGTGCTTTTTACTATTAAAATGAGAAAAGGGTCAGTTTG
AGGACCAGTAACATCCCTATGAGCCAATCACCTCTCTCCAGGCCCCACCTCCAAAACTGG
GGAATACAATTTGACATGAGATTTGGTGGGAACACAGATCCAAACCCTATCTCTGACTCT
CCTTGAGTGCCCTTCTGATTTGCCCTAAGAAGCTCATTTTATGTCCCTGACCTGAGTAGA
GTGGCATCTGGTTGGTGGTGCCCATCTCATATCACCAGGGACAAAGTAACCCCTTGTTCA
TCCCAGCTTGGCTTCTCATCTGTGCCTACGCCTGGTTCATGCCTTGGACACATTAAAAAA
AAAAAAAAGTAAAGCTCATTTTAAGGGATAACAGCATGGCAGAAAAAGCGGCAAATCAAT
GGGGCATTGGACCACCTGTGTAGAATAACCAGCGCACACCTGTGTACAAAATTAGAGTTT
GCATAAGGCAATCAATCATGAAGCCACACACACATGTCCCCAGCAAGTGAGGACGACACA
GGAAAAAGTGACTCTTCCAAATCCTTGGGGAAAAATATGATTCAGAACCCTTTTCAGAAG
TCACTGGTTTTTACTGTGGAGTTGTAAGAGGTCAGTCTGTGCTCTGGAAAATCCTGACGT
GAGAGGGACTTGTGTTCAGCTTCCTGTTAACCCCTTTTTGGAGTCTGCCTTCTCCTTTAG
CAGATAAACTCCGTTAATTCCAGGCGCTGTGCTGCAGTGGGGGGTTTGTCTTGGAAGTAA
ATCAGCTGGGTTTTCGAAACTGACAACCCATTTGCTGACAGTGCACTAATTTATTAATTC
TTACTCAAGTGTCAATGGCTGCTTAATTATGGCAACAGGCAAACAGCACTGGCATTTCAC
CAGACCTAACGTCGTAATAGTAGAACACCTACCGAGTGGGAATTTTCATTACACCCACAA
GAGCAAGGGGACGCTATTTTATCTACAGGTTGGCTGTGAGAGAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGCCCTATACTAATGTACCATTTT
TTATTTTATATACCATATTTTTACTGTACATTTTAATGTTTGGATGAATTTAGATACAGA
AATATTTACCATTGTGTTACAATTGCCTGCAGTATTCAGTACAGTAACCTGCAATACAGG
TTTGTGGCCCAGGAGCCACAGGCTAGACCATATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved