Macaca_mulatta Locus Mono:174:SNORD75
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:174:SNORD75
Macaca_mulatta
Mono:174:SNORD75
13
SNORD75
1001..1060
2060
GGGATTACATTCATGTGTCACCAAGCCTGGCTAATTTTTTGTATTTTTAGTAGAGACAG
GGTTTTGCTATGTTGGCCAGGCTGGTTTTGAACTCCTGACCTCAAGTGATCCACCCACCT
TGGCCTCCCAAACTGCTGGGATTACAGGCATGAGCCACCATGCCCGGCAATAATTGCTTC
TTAATTCAAACTTAAAAAAAAAAAAAGAAAGAAAAGAAAGAAAGAAAAAGAAAACACATG
GGGAACGCCAAAGCCCTAAAGAAAAATTTTTCTTTTTTTTTTTTTTGAGATGGAGTTTCA
CTTTTGTCACCCAGGGTGGAGTACAAAGGTGCTATCTCGGCTCACTGCAACCTCTGCCTC
CCTGGTTCAAGTGATTCTTCTGCCTCAGCCTCCCAAGTAGCTGGGATTACAGGCACCACG
ATGCCCAACTAGTTTTTGTATTTTTAGTAGAGATGGGTTTTCACCATGTTGGCCAGGCTG
GTCTCGAACTCCTGACCTCAGGTGATCTACCTGCCTCAGCCTCCCAAAGTGGTGGAATTA
CAGGCGTGAGTCACCATGCCCGGCCGAGAAAATATTTTTAAAAGAAATCCTTCATGCATT
CCGAAGTTACAAAATTCTTAAAGGAAGTATATCCAGAGTACTAAGCCAAAAGTCTGGAAA
TCAAGCTTCTGGGACCTAACCTGACACTAGAGTGACCATGGCTAAATTACAACCCACTGG
GAGCAGAGTTCCCTGGTTGCTAACATTTGGATCGGACAAAAGGCATACAACTGGGCCAAA
ATAGACCAGAAGGTTTCCACAACCCCCTTAGTTCCAACTTCCTATGACCCTATAAAATGA
TTAGACTATGTTTGATTGAATTGTATATTGCACACCATAAGGGAATGTACATTTATGAAG
AGTCAGAGGACTCGAAATAGTCTATGACACTATGCATTAAGTTTGGAGTTACACAGCTGA
ATAGTAATACAGGGCTAGGAGCTTTCAATGTTTTATTTTTCATTTCTATGGAAAAGAGGT
GAAGTGGACAGAAGGGATGTCTGAAATTCTATCCTGAGGCTTTAATATTTCAAATATTGT
TTTGCATCTTTTTGTCTATTTTCTTTAAAAAGAAAAAAAAAGAGGAAAATAAGCTGCTAT
TAGCAAATACCAAGCCAACAGGGAAAATTCTCCCAACACCAACATCCAAATTAACCCCAT
CTCCACCTCTTCCAGATCACAGGACATCTGGACAAAGGTTTAAAAAGAGAAAAATTATTT
TGACTTATTGACAGCCATTGTGGAAATAACTTTTCAGAAAGTACGAACTTACAAATGGGT
AGTTATAAGTAACTAAAAAACCCAAGAACAAATGCAACTGTTTCAATTAGCAACAATGAC
AATACAGTAATAAAAGTCTTGAATTTGTTCACTTTCTAATGTATTCCCTAATTTTGTTTT
TGTAATCCTAAAAATCCCATTTTAGAGAATACAAAACAAGTTACAGATTAGATCAAGTCA
TGTAAATTCAGGTGTGGTAAAATCAGATTAAAGATTCAGAGATGAGGGCTTTTTTCCTCT
TTGGGTATTTTAATTTAGGATAATGTCTGACTTACTGGTACCACTATAGATATTAATGAA
AACATTTCTGCCACGAAGACTGAGTTATAAGAGATGTCTGTAAGTATAGCTAAGAAAGAA
GTGATACTTAATGGGTTTTTTTTAAAAAGCAGCAACAGGCCAGGCACAGTGTCTCATGCC
CATAATCCCAGAGCTTTGGGAGGCTGAGGTGGGTGGAATGCTTGAGGCCAGGAGTTTGAG
GCCAGCCTGGGCAACATAGTGAGACCCCTATCTCCACAAAAAAAATAAAAATAAAAAAAT
TAACCAGCATGGTGATGCACACCTATAGTCCTAGCAACTTGGGAGGCTGGGGTGGGAGGA
CTGCTTAAGCCTAGGAGTTGGAGACTGCAGTGAGCTATGATCACACCAGTGCACTCCAGC
CTGGTCAACCAAGCAGAACTCTGTCTCTAGAAAAAAATAAATAAATAATGATAAAAGTAG
TAACACTCTGGGAAAGTTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved