Macaca_mulatta Locus Mono:206:SNORA72
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:206:SNORA72
Macaca_mulatta
Mono:206:SNORA72
8
SNORA72
1001..1179
2179
CAATCACCATAACCCAGGGTGCCCAGGTTTTCACTGTAAAGAAGTAGCCACTTGTAACT
GCTGCATCTTGAGTTCTTGTTGTTTCAGAAAAGTTTCAGAACAAAGGTGAAAGTCAAGCT
CTTACTGGGCNNNNNNNNNNNNNNNNNNNNGAGATGAATTTGGCAAACCCTCCTCATTAC
CATACTAAAAACGCAGCCCATGAAGGAGCTTACTCTCCATTTTCCATGCATGCATCATAG
GTAGAAGCATGATCAATGACTGTGCCTGCACTGCCTTTACTCCACCTCCATATGCAATGA
CTAAGCTAACCAGCCCAAAAAAAGGCTAATTTTCACCTTTATTCAGGGAGGCACTGCTTT
GGGGAACTACCTCTGGTTTCTTCCTTTCTTGTTGCAAGTAACAAAATGTCCTTGTTAAAT
CCTCCTTGGTTGTGATCTTTGGACTGTCACCCACCAAGCAATGGAACCCACCCATTGTGT
TGGTAACATTACTGACAATACCAAATGTTGGTGAGAACAGTATCAAGTATTTGTGTTGCT
TTCATATGTAGCTAGTAGGAAACATTGTCTTTTTCTCTGTTTTTAATAGTTTAACTTTTA
TTTTAGCTTCGGGGGTACAAGTGGAGGTTTGTTATATAGGTAAACTCATGACTCAGGGGT
TTGGTGTACAAATTATTTCACTTACCATGAGATCCAGAAATCCCACTCTTGAGTATTTAT
TCCAGTGAAATGAAAACTTATGTCCATGGAAATACTTTTATGTGTGTTCATAGAGATAAT
TTATAATATTGCCAAGCCAGAAACAACTCAGATGTCCACCAATAGAAGAGTGAATGGATA
ATGTAATGGAGAACTAGTCAGCAAAAGAAAGGAATGATTTGCTTGTGTATTCAGGAACAT
GGATCAATCTCAAAAGCATTGTGCTAGTGAAGGAAGACATACACAAAAGACTATATTGTA
CATGTACACAATTAATATCAAATTGTAGAAAAGACAAAACTCTGCCAATATTCTCATTGC
TCTGATTAATAATCAGGACAGGCTAAACATTTGCTGTATATATTTTTTAATTTTTAATTT
TAATTTTTGTGGGTACAACATTCGCTATATTGAGATCATGCATGTGTCCTCAAACCTAGT
TCTTTTCCTAAGTCTAGTTTTATAAATGCTAGTGATGAACCCGGAAAAGAAAAAGGAGAT
AAAAAAGACATAATAAAGAAGAGGCATAACTTTAGTAATAGAAACAGCTCAATGGTTTCC
CAGGGCTGCATTTGAGGGAAGACATTAATTACAAAAGGTCATGAGGAAAGTTTTTGGGGT
GATATAAATTTTCTGTATCTCAATTTTGGTGGGTAAGTGACTATACTAGTTTGTGAAAAC
ATAGGAAATATGTACACTTAAAATGAGCAAATTTTATTTTATCTAAATTATACTTACAAA
ATGTCCTTTTAAAATGATTGACAGTACCAAGTGCTACTGGTTAAGCACCTGGCTGAGACG
TGAAAGAGGCTGAACTCCTATACACTTGTTGATGAGAAAGTAAAATGGAACAAACACTTT
GGGAAACTGACCACTTCCCTCTCGAAGCTAGACACATTGCTCATTAAATATTCCAGGAGT
TCCATTCCTAAGTATTTGCCAAAAATAAATGAAAATGTACCTTTATACAAAGGCTTGTAC
AGAAATGCTTTTTGAAGCTTTATTCACAGTAGCAAAAACCAGCAAATCCTATATACAAGT
ATTAATCAAGAAGTGAATGATAAATAAAATGAGGTATATCCATAAAATAGAATAACAATA
TAAATGACCATAACAGTAACAATATAAGTGAACTATAGATATGTAAACATGGATGAATCT
CAGAGTCACTATGTAGATTGAAAGATGCCATATACAAAAAGTCCACATTGTACAATTCTA
CTTACAAAATGTTTTAAAATGCCAACTAATCTACAGTGAAAGAAAACTAATCAGTGGTTG
CTTGTCTATAATGTTCACTACTGGTGGTCCGGTGCCTCCCAAAAGCCTTACACATAACAG
GAATGACAATGACAATGACAATGATGATGATGATGATGATATACCTACTCGATATGTATT
TATTGAATATATAATGTATTAAGAGACTATTAATAATGACCATAACTCCTAAAGTAGAAT
TATGGTGGAGGCCCATTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved