Macaca_mulatta Locus Mono:268:SNORA26
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:268:SNORA26
Macaca_mulatta
Mono:268:SNORA26
3
SNORA26
1001..1129
2129
GCTCACTCTGCCTTACTATATGGACCTCTTATTTGGTTCTCGGAAATAATCTTCCTCAG
AGAGTTAGAAAAGATGAGAAATTGGTAGTGGCATATTGTTTCTGAAATATTAAGGAACTG
AGAAAAGATTTCCCCCATCGTGTGGCTTCTGAGAACACCACGTGTGTGGGGGGGGATCAA
GTGTGCCACGGGAGGGGTTTTGCTCATTAACCCACTCCTTCTCCAGGATTCGACTGCCCT
CCCACGTGGCTGACTGCGGAGCCTGTAATGAAGCTGACAGCACTTCCAGGCACGATTTTT
CTTCCTTAATGCATGGCTTCTTCAGAACAGAACCAATCAGAGCTTTATTTTATTCCATTT
CGATGAATCGGTTGCGGGATGAAGCTTCTTTGATGTTGGAGAAAAAGTGCCTGGATGAGG
GATTGATGAAGAGCAGAGAAAGCATGTCACCACCAAGTATGTGGCATGGCCAGCGACTTG
TGATAATTCAGTTGCAACCTTAGCGAGGACATACTCTGTGTTCAACATTGTGGAAGATTC
AAAATGAGTAAGAAAGGTCATTCTTGCTGTCCCAAAGCTTTCAATCCAGTTGAGGAGATA
AGATAGGGGACCAGGAGGCAGTAGTGGGCATCTCTGATTCACCCTCAGAGGGGATGAGGC
TGAAGGTTGGAGAGAGTGAGGCAATAATGGAAGTAAAGACATCAAAAGCATGTTTTAGAC
TCTGGTTCCTTTGGGGCAGGAAGGAAGCAGTTTAAGATGGGTGCAGATGTATTTACATTT
GTAGGATACTGATACCAGACTGAATTTAATACAGGTTCACTTCGTCTCCTTAAACATAAT
AAGCTGGACAAGAAGAAATGATGATCTGTTAGCAAGGAACATTGTAATTCCCAGTTCTAC
TGAAAGGAACATGGCACCTTGGAAAACTATTATTCCAAGCACGGGACAGAAAAATGTCAA
AGACTAGTAGGGCAAATCAGAAGGGTACACGACCCTTTCCTGGGCCCCGTTAAGGCTGAT
GCAATGCTTTAAGAGGCTAACACAGAAGGGTAAAGCTTTCTTTACCCTTTGGGTAAAACC
CAAAGAAGAGATTGTAAACTTCTCTTTGGATCCTGTCTGAAGTCACAGCTGGAAAAAAAA
AAAAAAGGAGTAGGGGTCCTAACAGAACAAATTTGAAAAGGCGATTATTTTTTGTTTTAT
TATCATCATTATTATTATTATTATTTTTGAGATAGAGTCTTGCTCTGTCACCCAGGCTGG
AGTGTGGTGGCATGATCTTGGCTCACTGCAACCTCCACTTCCCGGGTTCAAGTGATTCTC
TCCTGCCTCAGCCTCTCGAGTAGCTGGAACTACAGGCGCCCGCCACCACGCCCGGCTAAT
TGTTTTGTATTTTTAGTAGAGGGGCTTTTGTCATGTTGCCCAGCCTGGTCTCAAACTCCT
GGCCTCAAGTGATCTGCCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCGTGAGCCA
TCATGCCCGGTAGAAAAGGCTATTATTGAATAAACGTGGGATAACTTTAGTTTTAGAAAG
TAGGACTGCAAAAATTGAAACACATCGAACGTACAAAAATCCATGAGTTCATAATGATAT
TCCAAAAATATTTTCATAGTTAAAGGTACTTAAGGAATCAACTCATTAATTCAGTATCAA
TAAAGGGAAGGAATCAAGTATTTATGCTGCCCTTCCAAACATGACGGGGGAGTTCTCTAT
AGAAGAGCTACAGCTAATATATGCCACAGGAATGAAAACACTGGAATGCTACCATTTAGT
AAACCCTAACAAAATCATTCTAGCCACTGATGATCAATATCTGCTAAAATTATTGGGTGA
AATGTTAATAGGGAACTTTAGAATAGACGGGTCAGGCTGACAACATTTGAACTCTTTGAT
CAGTTCTAACATTATTGGATAGTGAGAGATTTTGTGCCTCCTGAATAAAAAGCAAAAGGA
AGTTCACAGCACCACCTATAAAGTATTCTTGGGTTTTTTGTTTGTTCTTTGCATTTCTTT
GTTGCTGTGTCACCCAGGCTGGAGTGCAGTGGCACGATCTTGGCTCACTGCAATCTCTGC
CTCCCAGGCACAAGCGATTCTCTCACCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved