Macaca_mulatta Locus Mono:202:SNORD77
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:202:SNORD77
Macaca_mulatta
Mono:202:SNORD77
8
SNORD77
1001..1067
2067
AGAGAAATGTAAAACAAATAAACAGTAGAAAAGAGAAAAAATAAAGCACATTGGTATTT
TAACTTAGCCAATGCTAAAAGTATCAACATTATGTAACCACTTAGAAGAACTATGTGGAG
GTTGCTACAATCAAAATGTACTCCATCTTTAAAAAGTTACCTATACAGATTTCAGATGAT
CATGTTTGTCAGTTTTTATTGCCATGGGTAAAATCTGTTATAGCACCAAATCACTTTTAT
AATATGTTGAATCAAAACTAGTAGCTTAGAAAAATGTTTTCAGTGAGAAATATATGGTTA
TGTCCCTTACCTTGAAGAATGAGTCTCAAGAAACTGACGGAAATGTTCAAACTCCAGTTT
GTTATTAAGCAGATCACTAAACTTAAAATGTTTGTATTCTGCAGGAACATTATCCCAATA
TTCTGTTCGTTTAGAGACATTAGAGAGTGATAAAATGCCACTTCCAATTTCACAAGTGGT
ATCCTGGTGAAACAGTACTTTTCAGAAAAAAAATCTTAAACACAACAAATTGTTTACAAT
TTTAAGTAGAGAAACTGAAAGAAAAATTAACCATTCGGCCAAGGCCATTTAACAATTCAA
TGGCAGAAGTGGGTAAAGACTAGAATCTTGTAAAGAATCTGGTTCAGATTCTAACAATCT
GGATAAAGAATCTGGTTCAGATTCTAACGTATCAAATTCTGTTCTGTTTATTTTCATTCC
ATTCCCTTCTTTTCACAAATATTTAGTAAATATTTACTACACAAAGCACTTGCTTGTAAA
TTAACCTTAATATATTTTTCTAAGTACAGAAGTAACATGCCTTTTGTAATAATAAAATAA
AAATCATACATAATACTACCATTCAAAGATAACCACCATTAACATTTTTTAATACAGCCT
TCCAGTCTTACTTATGTATATACATGTAGTTTATAAAAAATGAAGAAAAGTATAACAATA
AAAAATAAAAATAAAAATTAAAAATTAAAAGTGAAGATTAGATACTATGATGGTTGCATA
GTTCAGCAGATTGAATTCATGAAGAGATTTACAATGTCTGATATAGTTTTAAAATATAAA
GATAGGATTATGCACCTATTTATAGTTTTGTGACCTGGTTCTTTTTCTTAACAATGTTGA
TCATAAACATAAGACATTCTTTTATAACATAATATTTAAAAGTTATAGAGTAATACAAGT
TACTTATCTAATAATACATCCTTCAAATATAATATTAAAATATAAATATAATCACCATAT
AGAAGTTAATTTTTAGATAATTTTATGACATCTGATGTTTTGTGAACAGTTTATAAGAAC
GAAAGGGCAAAGGGGAAAAGAGGCTTATTCTTTGAAAGGCCCTTCCTTATACAATTCCTT
ACATAACTAATTCATCTCCCTATTTGTTTTTATAAAGGATCCATGAGATAAGCTACCAAT
GTTTTAAAAATTAATTTTCCTTATGTAGAAGGAGTGTGGATAGTGTTATAAAGTTTAGTT
CATAGAGTTTACAATACAACCTTATATCATGCTACCTTTATGGATTTTTATGTATCCTTT
GCAAGATAGTATTAGTGTATCAAATAGATAACTTCTGGATAAGAATAAAAATTTCAGATA
GGCACAAAGAAGAAAGTTTTAAAAAAATCACCTGCAACCTTACCACTCAGAGTTATCTTT
AATATTTTGGTGAGTGTCTTTTCAGATATTTCTTTTTATACATATGGATACATGCGGAAA
CACATATATAATTTTACATAAACAGGATCATACCATACCAGTGTTTCTGTTACAAAAATT
TTAATATATCTTAAACATTTTCCAGGTCAATTAACTGCCATTTTTATGTAGATGCATAAA
TTTAATTTTATGGCTTTAAGGATTTATTATGTTTACTTAGCCAATCCAAAAGATGCAACT
TTATGAATCAAAGTAACACTTTAATACCCTAGTCAATCCTATGATCTTTTTACCATCTTC
CTAAATTCCTTCCCATATTTTTTCTTTATTGATTTCCCTATTGCTGTCACACAACAGTTT
CTTTTCTGTTTAGAAAACTTAATTTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved