Macaca_mulatta Locus Mono:64:SNORD32
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:64:SNORD32
Macaca_mulatta
Mono:64:SNORD32
4
SNORD32
1001..1085
2085
CCCAAAATGCCACACTGTATCTTTTCCCACCACTGATACCTTTAGTGCTTATTAGGTCT
ATTAAGTCACATGGCCAAAGCAGTACCACATGGCTGATATGACAGCCTAGAACAACTGCA
GACCCCATGTCTGCTCTGGGCTTCAGTCAGTCGCTAGTAAACTGTTCCATGTGGTATTCC
CATGAGCGTGGAATATGCTTCCTCTAGAAACTAAATAGGACAGCCAAGCATTCTCTACCC
TGGAGAAGAGGAGGGAGAAGACCAAGATTCACTAGTGGAAGAAGAAACAGCTCATGAGGC
TACAGAAGCAGGTGGAAAAGAACGTGGAGAAGAAAATTGACAAATACACACAGGTCTCCC
CGAGACCTATGGATTCCTGGTCTGAGCCTAATAAAGACTGTTTATTCCAAAACACACACA
AACAAAAAACACTCCTGTATTATAAATTATTCTGTGTAATGGTGTGTTACTGTGTATCTC
TTTCCAGTTCTGCATTAGTAGTGTTACATGTGAAATGCAATAATGTGTTCTTACTTTAGA
GGGATATCCTGGCACGAAGTTTAAAAACTTCGAAGATGTGGAGGATGCTGAATCTTCACA
GGGTATATCTCCCACTCTCTGGAGTGCATTTGTCTTACCAGTGTCACCAATATGCTTGCC
CTCATGGCTCATTCTGTTCGATTAATAAGATATTGTTGATACAGTGGAACAATGTGATGT
TTTGCTGAATGTCCAGAAGGTCCAAGTTCAGTGGTGTGTTGCAGCTAGTTCATACTGCCT
CATAGAGCCAACAGTTAAATTTTCAGAAATTGTGTAAATCAGTTGTTAAACATGACTATT
ATTTTAAGAAGTTATTTTAAGACATAGGTAACAAATCCCTAAGCTCTTCATTTTCTAGGT
ATTTATCTTACCATATTTTCTATACTATTCTGGTTATTTATATCTGTTATGTCTGTATAA
TAAAAATACTAAATAATGTTGTCGTATAATAAAAATATTCTGGATCGGTGATGAGCAACA
ATCACCATCTTTCGTTTGAGTTTCATGGCCATGAGACCAACCCCATGCACTGCTGCTCTG
AGACCCGCCAGCCACTCCCATTCCTTGAGTGCGGTCCTCCTGGCTCAGAAGTGATTTTCC
ATTAGCCTGTCTTTTCATTTAAACATGAACTCCGCTCTGCCCATCACTGTCTGGGTGCAG
TCACAGGTAGAGGGAGAGCCTTCAGGTGGCACCCTCAGCACTTCCCAACCCTTTCCCTCC
TTCTAGGCCAGAAGGTGGTGGTCGTGCGCTGCGAGAGCATCAACATTTCTGGCAATTTCT
ACAGAAACAAGTTGAAGTACCTGGCCTTTCCGCAGGCCTTTCTCCGCAAGCAGATGAACA
TCAACCCTTCTCGAGGCCCTGCTATTTCTCGGCCCCAGAGGCATCTTCTGGTGGATGGTG
CAAGGCCGGCTGCCCCAAAAGACCCAGCGAGGCCAGGCCACCCTGAACCACCTCAAGGTG
TCTGATGGCATTCCGCCGCCCTATGACAAGAAAAAGCGATAGTGGTTCCTGCTGCCCTCA
GGGCTGTGTGTCTGAAGCCTACGAGAAAGTTTGTCTGCCTAGACACCCGGCTCATGAAGT
TAGCTGGAAGTACCAGGCAGTGACAGCCGCCCTGGAGAAGAGGAAGGAGAAGGCCAAGAT
CCGCTACCAGAAGAAGACACAGCTTATGAGGCTGCAGAAATAGGCGGAAAAGAACATGAA
AAAGAAAACTGACAAATACACACAGGTCTCCTCAAGACCCAGGGACTTCTAGTCTGAGCC
TAATAAAGACTGTTTGTTTATTCAAAAAAAAAAAAAAAAAAACCCTCTGTATTATAAATT
CTTCTGCGTAATGGTGTGTTACCATACATTTCTCTACAACTCTGCATTTTCAGTAATCTC
ACATTGACAGTTTAAAATTGGCCATGGTGAGAATATTTACACTATAGAAATCAAGGCTTT
TTTGCCGGAGTTGCAGCACATCCATGTCCCTATTATATGGACCCTATTATAATGGGAGAA
TTTTAACATGGTACTGAAGCAAAAATGTAAATGTAAATGTACACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved