Macaca_mulatta Locus Mono:9:SNORA25
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:9:SNORA25
Macaca_mulatta
Mono:9:SNORA25
1099214782347
SNORA25
1001..1127
1339
AGAGTCCTCAGAAGAAACCAAACGTGCTGACACTTTGATCTTGGACTCTAGCATCTGTA
ACTCTGAGAAAATAAAATTCTGTTGTTTAAGCCATCTCTCATTGCAGCTCCAGCAAATGA
ATATGCCCATCTTAAGAATTAGTAAAAGAGGCCAGGCACAGTGGCTCATACCTGTGATAC
CAGCACTTTGGGAGGCCGAGGCAGGTGGATCACTTGAGGTCAGGAGTTCGAGATCAGCCT
GGCCAACATGGCAAAAAACCCCGTTTGTACTAAAAATTAAAAAAAAAAATATATATATAT
ATATATACACACACACACCCACACACACACACACACACACACACATATATATATGTTAGC
TGGTCATAGTGGCGGGGTATCTGTAGTCCTGGCTACTCAGGAGGCTGAGGCAGTAGAATC
CCTTGAACCTAGGGGGCGGAGGTTGCAGTGAGCAGAGATGAAGCCACTGCACTCCAGCCT
GGATGACACAGTGAGACTCCATCTAAAAAAAAAAAAAAAAAAAGAGGAAGAATCAGCAAC
AGAAAAATAAAATAAACCAAAGAAAGTAAGTAGTAGGAATTAGCAAAGACAAAAGATAAA
ATTAATAGAATAGAAAACACCAAAATAGTAGGGAAAAGCCAAATACTGATGCTATGAACA
CAGCAATAAAATAAATAAACTGCTATTTGCCTGAATAGAGAAAAGAGATAGAAAACATGA
AAGATTAAGAATGGGAAGTACAGAGCTACAAATAAATGCAAAACAAAAGAGATGAAAATA
ATTATAAGAATACACCATGTAAAAGTCTGTGACAGCAATTTGATAACCTAGAAGAAATGA
CTTACTAACAAAATGAGCAAAATTAACCCAAGAAGAAATTTAAAAACTTTAAAAGAGTAA
TTAATATATAAACTATTACAAAGGTAATTGAAGATGTGGCACTAAAAAAAATCTGATTAT
TTAATAGCTGAAGCTTTTTTATTGAAAAAAAAGTATTCAGTAGGTCGTTCAAAGAGAGTT
TCCAGGCCTTGAAGCCAGGAACTCTAAAGGCTATGACAAGAGATTGAAGTTCTCCATAGG
ATGCCATAGTCATTCAATAGTGCTATGTTTTCCTGAAGGGATATAAGACTTAGCCACTCA
TAATCATACTAGGCCGTGATTGGTGATGTGGGAAAGTAAATACATGTCTCAAAGTTTTAA
AAAATTTAAAAATTAAAAGTGTTGATCTTACAGCTGAATGCAATCTAACAGTTAGCAGAG
ATAATTCTAATATCGTTTACATTATTTCAGATTATAATAAAGATGGAAAGCACCCCAATT
TGTTTTATGATGTTTATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved