Macaca_mulatta Locus Mono:250:SNORD74
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:250:SNORD74
Macaca_mulatta
Mono:250:SNORD74
3
SNORD74
1001..1076
2076
TATTCTCACTCCTAAATAACTTCCTCAAATGCAATGTTTCGCTTAAATAATCTCAACAG
CTTTCCCTATGTGCCCAAGATTACTTGAGACTGCATCAATGGCTGGCTCAAATACAGACG
TGGTGACAACTCAGCTCAGACCTGCAAGTCCTACAATAAATGGGGGGCAGCTGTGATACG
TGTCTGTCCAAGGTTCCCAAGATCTCCAATGCATTATTGATAACCTCATCACTCCGCTAA
AAGCAAAAGCTGACATTGTTATAATCTCAACCTTCTCCTGAAGAGCTCTGGCTTTGCCCG
GGTATTGATCACAGGAAGAAATAAACCAAAGGGTGAAACAGCACACGTAAAAATCCAGAA
GGTTGAGGTTTGCCTACACTAGCTATGAGTGCATTAACCACAATCACATGGCCTGTTTTA
GTGTGTTATACCTTTAATGGTTTACAATGCAGTCCTATTTCTAGGCTATATGTTGTAATA
ATTCATTTAATACTTCACATCTTGAGCTTGTTACAAGTTATTCTGGAACAAAAGTCTGTA
TTACAAAATAAAAATAAACCTCCGATGTAGTTGTCTAAAAGGCAGATTTTTTTTCTTCAT
TCTAGTAAATTTTTTCTATAACATTTTGAAATTTAATTACATATAGGTGACTGTTCTTTC
TTCATCTATCTTCTTTCCATTGCATGTTACCTTCATGGAAAAATATGTACCTACAAAGAT
ACTCTATATAATTTTACTCTTTTATTATTTTAAATAATAATGTAAGACTACAAAATATAT
TAGTGCCTACGTTCTTTTAAAATTTTAGATATGATTTTAAATTATTTTTAAACGATATGT
TGAATAATATGACAAAATATAAATGTCACATCACAGGTAGTTCAAAGTGAGAATTAGAAA
GTATATCCAAAGTATGATTTAAAGCTTAAATATTTTATATTTTCTACGTTCATACTTGGA
GATACAATCTTAAGTAGCCTATCTTTGCTACTAAAAAAAAGGAAAACAGTTTCTGATGAA
GCCTATGTTGGTAGAGACAACTAAGGTTGTTGATGAATGCTGACAGCTCTATCACACGCA
CACACACACACACACACACACACACATGACAGTGAGAGACCATTATTTTTTTAGCTGGTA
GATGACTAAGTAGTTTGCAAAATGATCATTAGTGGCTGGTTGCTCCTGGATTCCAGAGCA
AAAGAGCTTACAATTCAAACATTATTTATGAGTGAAAACAGCTGGTCATAAGGCACTAAG
AGCAAAACATACAGAGTTTGGTTTCACCTGCAGACAGTGGTCACCTGAAGCAGGAGCTGA
TGGCTGCCTGCCCAGGTAAGACACATGGTATGCAGCAGTGAACCTGTTTCATCCACCTTT
GACTTGCCAGGCCTTGTATGTGCTGTCTTGTAAATTTGCCCCAATTACAGATTGATATTG
TTCACCATGAAATTAAGGCCCCAGAAAATGTGAATATAAGAGTAGTTATAAGTCTTTATA
ATGTATGCCTTTACACATATGCCTCTATTGTGAGGCATACAAAATTCTTAGCATGTTCTA
AAATAAGTAAAAACAAAAGCACCCCATGGTTTATCACATCGTTTTGTTATGCTTTATGCT
TTTTAATGAAGCCATTGCTCACTTTCCTAAGTGCTGCAGGAGCTTAACCCCTGGGAAAAG
ACAAGTTTCATGGAATGTGAAACTTATTTGAGCAACAGAAACTAGAACTATCTTGGAATA
AATATGTTCTACATCTGATCATTTTTTATTTCACTTATTGCTGTTTGCTTTAGTTGGTGG
GCAGTCTATTTAGTAAAAGTCAGACTACTGCTATGCACGAGTACATCACTTAAAAAAAAC
TCACGAAAGTATTAAAAATGACAGCAGAGTTTTAGGTAGCATTAGAGTGGGTTCTGGTCC
TCTAAATGTGTGTGCACCTCACAGTGGGGGAATTTGATTAACCCCAAGTGTGCCAAGTAA
ATCAGAGCCCAGGAGCTGGATACAAAGGCTCCGTAGTGTGAGTTCACACAGAGAACATAG
TTTCTGCTGAGGGGTGGTGGTGGTTGTTGATGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved