Macaca_mulatta Locus Mono:141:SNORA33
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:141:SNORA33
Macaca_mulatta
Mono:141:SNORA33
2
SNORA33
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTGATCCCACCATTGCACTCCAGCCTGGCTGACAGAGTGAGATC
CTGCCTCAAAAAAAAAAAAAAAAAAATTTAAGCCAGTGATAGTAAAGCCATGTTATGAGC
TTTAAGGACATTGAAGTCATTAAGATTCCTGGAAATGGCTACAACAAATTTTTTTAAAAA
ACAAAAAAACTAGACATGAAGTTTATTTTATTTCTCTTCTCTTTGAACTTTATATGGCAG
ACACACCTGACACCAATAACTTAACTCAAGCATACGCTGAGAATGACCCTATGGTCTAAG
AAGAATGTGCATTTGGCGTTCCGAGCTAAGGAATTCAGGAGTGGCCAACCCAGAGACTCA
CTCATTATCAATGAAGGACATTTCAATCCTTGGCCCATTCCTTGGAACGTGAGCTGTACA
GGGAATGAAGGCCCTTTGTTCTGGGTTAAAAGAAGGTTGCTAGGTGGAGGCTGCTAAATA
AAAATGCTGTGTGTAGGCTGGGTGCCGTGGCTCATGCCTGTAATCCCAGAATTTTGGGAG
GCCGAGACGGGCAGATCACCTGAGATCAGGAGTTTCTGACCAGCCTGGCCAACATGGTGA
AATGTTGTCTCTACTAAAAATACAAAAATAGCTGAGCGTGGTGGCACACACCTGTAATGC
CATCTACTCGAGAGGCTGAGGCAGGAGAATCACTTGAACCTGGGAGGCAGAGGTTGCAGT
GAGCCGAGATAAGGTCACTGCACTCCAGTCTGGGCAACAGAGTGGGACTCCATCTCAAAA
AGAAAAAAAAAAAAAAAAAAATGCTATGTGTGTGTGTATATACATTTTTTTTTTTTAATT
AAAAAAAATAGAGCAAGCGATCTACCTGCCTTGGCCTCTAAAGGTGCTGGGATTACAGCC
ACCATGCCCAGCCACAAATGCTATATAAACTACATGCTTTTTACAAACGGTAGTTGTTTT
CCCATCCAGTCTGCCACCATTGGACCATCCCTGTATATAAGTTCCCCCAATAAATCCTGT
GTCTTGTTTGCTTTCTTTCAGCCTCTCGGACATGATGCCATCCCTATTGGAGTTAATATG
GGTCTGGCAAGACAAACTGGGGCTGGTCTCATGGCATGTTATGCCAATGGAATGCAGTCT
GAGTAACACTGTGCCAGTTCCAGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved