Macaca_mulatta Locus Poly:4:SNORD115
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:4:SNORD115
Macaca_mulatta
Poly:4:SNORD115
7
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1082, 2887..2968, 4199..4280, 6115..6196, 8009..8090, 9876..9957, 11781..11861, 15273..15354, 17187..17268, 19114..19194, 22762..22841, 24566..24646, 26456..26536
27536
GAATGGGTAAGATGAGAAAAAGGCATAAAATGGTCAAAAACACTGGGAGAATTCAAAGT
TAATTTTGACAATATTAATACAAATAGAAAAACTGACAAAAAAGGAAATACATCTTACAT
TCGAAAACATATAAGTAGTTGTATACAAATGAAGACACGTACCAAAAACAAATTACAAAA
TATGAATCCATATATATATATAAAATGTACAATTTCAAACAATTCAAAAGTGAAAAGATG
CAGGACAATAAAATATTCACAAACACGCTCGAAAAATAAATGCTGACGTCCGAATTAGAC
CAGTTCAACGGAAGTGTGGGGCGTGGATGGGGACCTACTGCAAAAATCACGTGGCGCCCA
GGCCAAGGCTTCGATTTCCGGTGCGCGCTTGGAGAGGATGCCTGGGAGGGCACCCACCAT
GCCCAGGGGCAGGCTGTGACTGCCAGGTATGCAGCTGTGAGTGGTTTCTGGGCCAGCCTC
TCTGGTTGGTCATGACCTGGTTGGTGGCCCTAGCCTCTGCCGCGTGGTCCTGGAGTGGCC
CAGGGGGTCTTGCTGGGGGAGCCGGCTTGGGCAGCGGAGGTGCTCCCGGGGGCCTGCAGT
AGGGCACACCCTCTGCATCTTGGGTGAGCCCAGTGACCCGCCTGCCCTGTCCTTCCAGGG
TTGGGTGGCAGGGAGGGCCAAGGGTGTCTCGCATCTGTCATGGGTCAGTGTTTCCAGCAA
GTGGGTCTATGGAGAAAGAGCATACCTGAGTCTGCGCACCCTACTGCCTTCATGAGGTTC
TGTTTGGACACCTGTCCTACTCCTGTCCCCCCAGATGGTGACCGCGGAGGAAGACTTGCG
TTGGGCCCAATGGCCCTGGGCCAGTGTCCATCAGCCAGGTGCCAGCCCCTGGTGCGCTGA
AGCTCAGGCCCTTCCCGGCGCCCTGGCCTCCTGCACTGAGCTGTGGTGAGCTCATCCGGG
TCCTGATGGATACATGCGCGGGGAGGGTTGTGCCCTGGATTGGGTCGATGATGAGAACCT
TATATTTTCTTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCCAGTCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCAGAGGCCCCCGACAGGGCC
CCTGTATTTTGGGCTATAGACCTAGAAGCCCTGAAGGGCATCTGGAGGGAACCCAAGCCT
GGCTCTGAGCTCCTCCATGAGGCAGTCCAAGCTCCCTGTGTGGGCATATGCTGGGGCTCT
GGTTCCCTAGGGGCAGGGCATGTGGGTGGCTCCTCCCTGACCTGCATTCTCCCCTGTGTC
TTTCAGTGAGCTCTTCCGCCCAGGCAGCGCCCTGGCATTGACTGGCATAGGTGAGTGGAT
CCTGCTGGGGTCATGGGCCATGAGCCAGGCTGGTGGGGTCACCAAGGGTCAGCCTTTGGG
ACAGGAGGGTTTCCTTAGGGAGCCGACCTGACCTGAATCCCCACTGAGGAGGGCTAGGTT
CTCCAGGAGGGCGGCTTCCTTGGGAATCTGACCCAAGGAGGTTATCTTCTCTAAAGCCTT
GCAGCGGTGATGGTGGTCCAGGCAGCAAAGGATTCCTTCAACCCCACCCAGGGCAGTGCC
CAGCTGAGACTCAGTGGGCAGGTCTGGCCTTGAGGACTGCCCAGGCCACATGAGGGGGTC
CATAGGAGCTCCAGGGCACCACAGGGGTCACACAGGAGCTCTCCTTCCCCAGAGACGGGT
GAGCGATCGAGTCCATGGGGTCAGGCCTTTGGAGATTCAAGGAGTGGGCCCCACCTAGGA
CCCTGAATGGGACCGAGCCTTTGAGCAATGGGCCATCCCAGTGGTGCCTGTGAGCCTAGT
GGGGGGCGATGCGGCTTCAAGGGGGTTGGGTCAAGGCTGAGCTCTGGCCGGTACTTGGTA
GTGCTGCAGGCTGGCCCTGGGACTTGCTGGCTTTGGGCAAAAGGGCCAGCCTGCATCCTG
CTGGTGGTCACCCATTCCCCATGGGCAACTAGCGGAAAGCTGGCATCCTTAGGTGGGAAG
GCCCGCTGTCAAGGGTCCTGTCCTGGAAGTTTGCTTCCCAGGCTGCTTCTGATCCATGGA
CTCACCTCCAGGGTGGTGGGGTCTTGAGCCCGAGGAAAGGAGAAGATACCATGTGTTCCC
CGATTGGCCGAATGTGGCTCGGCTCTGTGTTTGGGAGGTGTGTAGGGCATGGATGGGGAC
CCATCAGAGAACACATGTGGCCCGGGGTCACAGGTTGCGATTTCCCATGCACACTTGGAG
AGAACGCTGGGTGGGTGCCCTCCACTCCCAGGCACAGGCTATGCAACTACCAGGTCTGCG
GTGGCATGTGGCTTCCAGGTCAGCCCCCTTGGTGGGCCATGAGCAGGTTGGTTGCCCTGG
CCTGTGCCCAGTGGTCTCGGAGTGGCCCAGGGGTCCTGTGGGGGAGCTGATGTGGGTAGT
GGAGGTGCTTGTGGGGCCTGCAATAGAGTGCAGCCCAGGTGTCTTGTGGGAGCTCGGTGA
CCCACCTGCCCTGACCTAGGGTGCGGTGATGGGGAGGGCCAAGGGTCCCCTGTGTCTGTA
ATGGGTCAGTGTTCCCATCACATGGGTCCATGGAGGGACAGCATGCATGAGCACCACCCA
CCACCATCCCCCTATGGAGGCGTGAGGCCATGTTTGGACACATGTCTTCCTGTCCCCCAG
ACGGTGAGCCTGGAGGAAGACTTGCCTTGGGTCCGCTGTCCCTGGGCCAGTGTCCATCAG
CCAGGTGCCCAGTCCCCAGTGCGCTGAAGCTCGGCCCTCCCTGGCACTCTGGTCTCCTGC
ACTGAGCTGTGGTGAGCACATCCAGGTCCCGCTGGATGTTTGTGTCGGGAGTGGGGTGCC
CTGGGTTGGGTCAATGATGAGAACCTTATATTTTCTTGAAGAGAGGTGATGACTTAAAAA
TCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACACT
GGGATCCCCGGCAGGAGGCATTTGGGGCTGGAGACCTGGAGGTCCCGAAGGTTATCTGCA
GGGGCCCCAACCCTGTCTCTGCGCTCGTCTGTGAGGCAGCCCAGTTTCCCTGTGCGGGCT
TGCTGTCAATGCTCTGGTTCCCTGAGGCGGGGCACGTGGGTGACTCATCCCTGAAGTCCC
ATTCTCCCTTTGTGTCTTTCAGTGAGCTCTTCCGCCCAGGAGGACCCCTGGCTTTGAGTG
GCATAGGTGAGTGGATCCTGCTGGGCTCATGGGCCATGGACTAGGCCACGTGGGATCACT
GAGGGTCAGCCTTCAGGATGGGACGGATTCCTCAGGGAGCCAACCTGAATCCCCACTGGG
GAGGGATTGGTTCTCCAGGAGGGCCGCCTCCTTGGGAATCTGACCCAAGGACACCTTCCC
TGAAGCGCTGCAGGAGTGACATTGGTCTAGGCAGGAAGGGTTCCATTGGTCCCACACAGG
GCAGCTCCCAGCTGAGACTGGGCACTAGGATCTGGCCCTGAGGACTGCCCAGGCCACATG
AGGCTGGGTCCCAGGCTGCTATTTGCAGTGTGTGCTTGGAGAGGGAGCCTGGGTAGGCCC
CCTCCCCGTGCAGGGGCAGGCTGTGCGTCTGCCAGGTCTGCAGCAGTGCCTGCCTTCAGG
GCCAGCCTCCTTGGTGGGCCTGAGCTGGATAGTGGCCATGGTCCCACCCAGGGGTCATGA
TGCAGCCCTGGAATTGCAAGGGAGCCACCATGGGGAGTAGAAGTGCTCCAGGGGCCTGCA
TTAGGGCACAGCCTGGGCATCTTGCCCAAGCCCAGTGACCAGCCTGCCCTGTTTTCCAGG
GTTCAGTGGCAGGGAAGACCAAGGGTCCCCCGCGTCCATGACCAACACTGTTTCACATGG
ATCCCATCACCTGGGTCCATGGAGGGAGAGCATGTGTGAGCTAGCACCCCCTGCCTCCTT
TCCCGCATGGAGGCATGAGGTTCTGTTCAGACACTTTCCTCTGTCCCCCAGATGGTGACC
CTGAAGGAGGACTTGCATTGGGCCCAATGGCCCAGGGCCAGTGTCTGTCAGCCAGGTGCC
CAGCCCCTGGCGCACTGAAGTTTTGGCCCTTCCTGGCTCTCTGGTCTCTTGCACTGAGCT
GTGGTGAGTCCATCTGGGTCCCACTGGATGCATGTGTGGGGAGGGGGGTGCCCTGGGTTG
GGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTC
AATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATGTTGGAAGAGGATGCTGGGATCCT
GAGATCCCTGGCAGAGCTACTATATTTTGGGATGGAGATCTGGCAACCCTGAAGGGCACC
TGGGGGGCCCAACCCTGTCTCTGCGCTCCTCCGTGAGGCAGCCCAGGCTCCCTGTGCAGG
CTTGCTGTTGGCACTGTGGTTCCCTGGGGTGGGACACGTTGGTGGCAGCTCCCTGAGCCC
CATGCTCCCCTTGTGTCTTTCAGTGAGCTCTTCCAGGAGGGCCCCCTGGCATTGACTGGC
ATAGGTGAGTGGATCCAACTGGCATCATGGGCCATGGTCCAGGCCGCGTGGGGTCGCCAA
GGGTCAGCCTTTGGGAAAGAAGGGTTCCTCAGGGAGCCAACCTGAATCCCCACTGGGAAG
AGATGGGTTCTCCGGGAGGGTGGCTTCCTGGGGAACAGGAACCAAGGGGGATGCCTTCCC
TGAAGCCCTGCAGGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCAGTTCTACCCAG
GGCAGCTCCCAGCTGAGTCTCGGGGCTTGCATCTGGACTGTCCTGACTATATGTGGGGGC
CACAGGGGTTCTGGGGTGCCTTGGGGGTCACACAGGAGCTCTCTGTCCCTGGAGAAAGGT
AAAGGTGGGTGATCAGGCCCATGGAGTTGAGCTGTGGAGATTCAAGTATCGTACCTGACA
CATGGCCCTGAATGGAACCCACCCTGTTGAGCAATGGGCCAACCCATGGGCCTCTTCGAG
CCTGACAGGGGGCGGTGCTGTTTCACTGGGGTTAGATCGAGGCTAAGCTCTGGCTGGCGC
CTGGTGGTGCTGCAGTCCGGCCCTTGGACTCATGGGCTTTGGGCCAAGGGGGCAGCCTGC
GTCCCACTGAAAGTCACCGCTTCCCTGTGGCTGGAAGTTATCCCTTCGCAGTGGGCTAGT
GTCAGGAAGGGTGGCCTCCTGAAGTGGGAAGGCCCGCTATTGAGGGTCTGGTCCTGGAAA
TTTGCTGCCCATGCTACTTCTGAATCCTGAAGACACCTCCAGTGTGGTGAGGTCCTAAGC
CCGAGGAAAGGAGAAGACACTGTGCCCTCCGATTAGTTGAGTGCAGCCAGGCTGTGTGTT
TGTGAGGTGTGAGGGCATGGATGGAGACTCACCAGAGAAAGCACATGGCCCTGGGATCCC
AGGTTGTGATTTCCAGTACATGCTTGGATACGGCACGTGGGTGGGTGCCCACCATGCACA
GGGACTGGCTATGTGACTGCCAGCTCTGCAGCAGCATCAGGCATCCGGGCCAGTCTCCTT
GGTTGACCATGAACTGTTGGTGGCCCTGGCCTGTGCCCGGTAGTCCTGGGGTGACCCTGG
TGTCATGCAGGGGAGCTGGCATGTGTAGTGGAGGCGCCTGTGTGGCCTGCAGTAGGATGC
AGCCCTGGCTTGTAGCCTGAGCCCAGTGACCTACCTGTCCTGTCGTTTCAGGGTTCAGTG
GTGGAGACAGCGTTGGGTGCCCTGCGTCTGTGATGGGCCAGTATTCCACATGGATCTCAT
CACATGGTCCATGGAAGGCGAGCATCCCTGAGCTGGCACACCCCACCTTCTGCCCACATG
GAGGGGTGAGGTTGTGTTTGGACACCTGTCCTCTTCCTGTTCCTCGAGATGGTGACCCCG
GATGAGGATTCGTGTTGGGCCCACTGTCCCCGGGCCAGTGTCCATCAGCCAGGTGCCTAG
CCCCTGTTGCACTGAAGCTCTGGCCCTTCCTGTCACCTTGGTCTCCTGCATTGAGCTTGG
GTGAGCCCATCGGGGTGCCACTGGATGCCTAAGCAGGGAGGGGGTGCCCTGGGTTGGGTC
GATGATGAGAACTTTATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATA
GGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACACTAGAATCCTGAGG
TCCCTGGCAGGGCCACTGTATTTTAGGCTGGAGACTTCGAGGCCCTAAAGGGCATCTCAT
GCAGGAGCCCAGCCCTGTCTGTGCTCCTCCATTAGGCACACCAGGCTTCCTGTGTGGGCT
TGGTGTCTGTGCTCAGCTTCCCTGGGGGCGGGACAGGTTGGTGGCTCCTTCCTGAGCCCC
ATTATCCTCGGTGTCTTTCAGTGAGCTCTTCCGCCAAGCAGACCCCCTAGGATTGACCAG
CATAGGTGAGTGGACATTGCTGGTGTCATGGGCCGTGAGCCAAGCGGTGGGCAGTCCCTG
AGGGTCAGCCCTCAGGCCACCTGGGTTTCCTCAGGAGTCGACCTGAATCGACTGGGGATG
TGTCCTCCAGCAGGGAGGCTTCCTTGGGAATTGGACACAAGGTAGAGGCCTTCTCTGAAG
CCCTGCAGGGGTGGCAGTGGTTCAGGCAGGAAAGGGTTTTCTCAGCCCCATGCAGGGTAG
TGCCCAGCTCAGACTTGGTGCTTGGGTCAGGCCTCTAAGATGGCCAGGACACATGAGGGG
GGCAACAAGGGCTCTGGGGCACCACGGGCATCTCATGGGGACTCTCCAACCCTGGAGAGG
GGTGGGCGATTCAGTCCGTGGAGTCGGGCCATGGAGATTCATAGACTGCAGCAAACCCAT
GACCCTCAATGGAACCGACCCTATAAGCAGTGGACCCTCCCAGTGGCATGTCTTTGAGCC
ATGTGAGAGGCGGCGCTGTTTCTCTGAGGTTGGGTCAAGACTAGCTGTGGCCAGTGCCTG
ATGGTGGTCCAGTCTGTCTCTGGGACTTGTGGGCTTTGGGCCAAGGCTGTAGCCCGTATC
CCACTGGGGGTCACCCCTTCCTTGTGGGCGAGTGGCGGTAATGGTGGCCTCCTGAGGTGG
GAAGGTCCACAGTGGAAGGACCTTTCCTGGAAATTTGCAGTCCAGGCTGCTTCTCAGCCA
TCAGGACAACTCCAGAGGTCAGGGTCTTAGGCCCAAAGAAAGGAGAAGACACCGTATGTC
TCCCGGTTGACTGAGTGTGGCCCCGCTCTGTGTGTGGGAGGTATTGTGTGGGGCGTGGAT
TGGGACCCACCAGAGAAAGCTTGTGGCCCTGGAGCCCCAGGCTGTGATTTCCAGTGGACC
TTGAGGAAAGGAGGGTGGGTGCCCTCCATGCACAGGGCAGGCTGTGCAACTGCCAGGTAG
GCAGCAGCCCGTGGTGTCCGGGCCAGCGTCCTTGGTTCGCCGTGAGCTGGTTGGTGTCCA
TGGCCCCTGCCCAGGTCCAGGTGCTACCCGGGGTTGTGCAGGGGAACTGGCGTGGGCAAT
GGAGGTGCTCGAGGGGCCTGCAGTAGGGCACAGCCCAGGTGTCTTGCCTGAACCCAGGAA
TCCACCTGCCCTGTCTTTCCATGGTTCAGTGGCTGGGAGGGCAAAGGGTCCCCCCCATCC
ATGACACATCAGTGTTTTCCATGGATCCTATCACATGGGTCCACAGAGAGAGAGCATGTG
TGAGCTAGCACCCCCCACCCCCTTCCCCGTGTGGAGGCCCGAGCCCCTGGTTGGACACAT
GTCCTCCTCCTGTCCCCCCAGATGGTGACTGCAAAGGAAGACTTGCTTTGGGACCACTGG
CCCCAGGCCAGTGTCCATCAGCCAGGTGTCCAGCCCTTGGTGCACTTAAGCTCAAGCCCT
TCCTGATGCCCTGGTCTCCTGCCCTGAGCTGTGGTGAGCACATCTGGGTCCAGCTGGATG
CACGTGTGGGAAGGAGGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTAAATTGTCCTG
AAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGT
GAGAATTTTGGAAGAGGATGCTGAGATGCCAAGGTCCCTGGCAGGGCCGCTGTATTTTTG
GGCTGGAGACCTGGAGTCCCTGAAGTTCATCTTGGGGTGCCCAGCCCTATCTCTGCACTC
CTCCGTGAGGCAGCCCAGGTTCCCTGTGCGGCCTTGGTGTCGGCCCTCTAGTTCCCTGGG
GTTGAGGCACACTGGAGGCTCCTCCTTCCTGAGCCCCTGTTCTCCCCTGTGTCTGTGTCT
TTCAGTGAGCTCTTCTGCCCAGGGGGACCCCTGGCCTTAAGTGGGATAGGTAAGTGCATC
CTGCTGGGGTCATGGACCATGAGCCAGGTCGCTTTGGGTCACTGAGGGTCACCCTTCAGG
CCACGAGGGATTCCTCAGGGAGCCCATCTGAAACCCACCAGGGATGGATGGTTTCTTCAG
GAGGACAGCTTCCTTAGTAATTGGTCCCAAGAAGGATGCCTTCCCTGAAGCCGTGCAGAG
ATGACAGAGGTCCAAACAGGAGAGGGTTCCTTCAACTCAACGCAGTGCGTGTTCTAGCTG
AGACTCAGTGCACAAGTCAGGCCTGGAGGGCTTTCCAGGCCACATGAGGGGGTCCACAGG
GTCACTGGGGGCAATGGGTGTTTTGCGGGAGCCCTCGGTCCCCGAGGCTTGCAAAGGGGC
AGGGTGTGGGTGATCGGGCTTATGGAGTCAGTCCGTGAAGATTCAAGGACTGGGCCTAAC
CCATGGCCCTGATGGGACTGACCTGTGGAGCAATGGGCCATCCCAGTGGTGCCTCCTTGA
GCCTGGTGGGGGCGGTGTGGCCCCAGTGGGTTTGGGTCAAGACTGAGCTCTGGCCTTCAC
CTGGTGGTGCTGCAGGCTGGCCCTGGGAATCGTGGGCTTTGGGCCAAGGGTGCAGCCTGC
GTCCAGCTATAGGTCACCCCTCCCCGAAGTGGAGTGGCCAGAAGGATGGCAACCTGTGAT
GGAAAGCATGCTGTCAAGGGTCCTGTGCCGGCAATTTGCTGCCCAGGCTGCTTGTAAGTC
ATGGGGTCACCTCCAGGGTGGCGGGGTCTTGAGCCGAAGGAAAGGCAAGGACATCATGTG
TCCCTGATTGATTGAGCATGGCCCAGCTCTGCGTTTGGAGGTATGTGGTGCATGAATGGG
GACCCATCAGAGAAGGCACGTGGCCCTGGGGCTCCAGGATATGATTTCTGGTGTGAGCTT
GTAGAGGGTGTCTGCTGTGGCACGTAGCATTCAGGTCAGCCTACTTGGTTTGCTGTGAGC
TGGTTGGTGGTCCCGGCCCTGCCCAGTGGTCCCGTTGTGGCACAGAGTCATGTGGGGGAG
CTGGTGTGGGCAGTGGAAGTGCTCCAGGAGCCTGCAATAGGGTGCATCCTGGACATCTTG
CTCAAATCCTGTGACCCGCCTGCCCTGTCCTTTCAGGTTTCCGTGGCAAGGAGGGCCAAG
GGTTCCCCGCGTTCTTGACCATCACTGTTTATAGGGATCCCATCTCTTGAGTCCATGGAG
GGAGAGCGTGTGTTAGCCAGCACCCCCTGTCCACTTTTGTGCATGGAGGTGTGAGGCCAT
GTATCTACACCTGTCCTCCACCCCTCCAGATGGTGACCCCAGAGGAAGACATGCGTTGGG
TCTGCTGGCCCCGGGCCAGTGTCTCTCAGCCAGGTGCTCAGCCCCTGGTGAGCTGAAGCT
CAGGCCCTTCCTGGCGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTCCC
TCTGGATACATGTGCAGGGAGGGGGTGTACTGGGTTGGGTCAATGATGAGAACCTTATAT
TGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAGTAGGATTACACTGAGGCCCAG
CCTAGGGGAGAATTTTGGAAGAGGATGCTGGGATCCCGAGCTCCCTGGCATGGCCACTGT
ATTTTAGGCAGGAGACCTTGAGGCTCTGAACGGCATCTCTGAGAGGCCCAACCCTGTCTC
TGCGCTCCTCCTCGAGGCAGCCCAGGTTCGCTGTGTGGGCTTGGGTTCCGGTTCCCTGAG
CCCCCATTCTCCCTTGTGTCTTTCAGTGAGCTCGTCTGGCTAGGTGGGGCCCCGAGGCAT
TGACTGGCATAGGTGAGTGGTCCTGCTGGGGTCATGGGTCATCAGCAGCGAGGGGTCACC
GAGGGTCCGCCTTTGAGACAGGAGGGTTTCCATGGGCAGCCGACCTGAATCCGCACCATG
GAGGGGTGGGTTGGTCCTCCAAGAGGGCTGCTTTTCTGGGAATCAGACCCAAGGAGGATG
CCTTCCCTGCAGCCCTGTGGGGATGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCAGTCT
CACATAGGGGAGCTCCCAGCTGAGTCTCAGTGCACTGGTCTGGCCTTGACGACTGACCAG
GCCACATGAGGGGGGCCACAGGGGCTTCAGGATGCCATGGGGTCACACAGGATCTCTCCA
TCCCCGGAGAAAGGTGGATTCGAGCTGCAGAGATTCAAGAATCACACACAAGTTATTGCC
CTGAATAGGACCGACCCTGTTGTGCAATGTGCCATCCTAGGGCACCTCTTTGAGCCTGAA
GGGGGCGGTGCTGTTTCCCTAGGTTTGGGTCAAGGCTGAGCTCTGGCCGGTGCCTGGTGG
TGCTATTGTCCAGTCATGGGCTCGTTAGTTTTAGGCCAAGGGGTCAGCTCTGTGTCTAAA
GGATCCCCTGTACTGGGGATCTCCCCTTTCCTGTGGCTAGAAGTCACCCCTTCCCCACTG
GCAAGAGTCTCCCCATTGGCAAGTGTCGGAAAGGGTGGCCTCCTGAGGTGGAAGGCCTGC
TGTCAAGGGTCTTGTCCCTAGAATATGCTGCCCATGCTGCTTCTGAGCCACGGGGTCACC
TCCAGGGTAGCGGGTCTTGGGCCCAAGAAAAGGAGAAGTCACCATGTGTCCCCGATTAGC
TGAGTGTGGTCCTGCTCTGTGTTTAGGAGGTGCGTGGGGCATGGATGGGGACCCACCAGA
GAAAGCATGTGGCCCTGGGACCCCAGGTTGCGATTTCCATTTCATGCTGGGATAGGGCAC
CTGGGTGGGTGCCCACAGTGCACAGGTATAGGCTATGTGACTTGCAGGTCTGCAGCAGCA
TCTGGCACCCGGACCAGCCTCCTTGGTTGGCTGTGAGCTGAATGGTAGCCCTGGCCTGTG
CCCAGTACATCTGGTATGACCCTGGGGTCCTGTAGGGGAGCCAGCATGGGCAGTGGAGGT
GCTCATGGGACCTGCAGTAGGACACAGTCGGGGCTTCTTGCCCGAGCCCAGTGACCTGCC
TATCCTGTCTTTCCAGGGTTCGGTGGCTGAGAGAGCATTGGGTGCCCTGAGTCCATGATG
GGCCAGTGTTCCACGTGCATCCCATCACATGGGTCCATGGAGGGTGAGCATCCCCTCAGC
CGACACACCCCACCTTCTGCCCCCAAGGACGGGTGAGGTTGTGTTTGCACACCTGTCCTA
CTGTTTCCCCAGATGTTGAGCCCGGAGGAAGACTTTGCACTGGGCCCAATGGCCCCAGGT
CAGCGTCCGTCAGCCAGGTGCCCAGCCTCTGGTGCAGTGAAGATCAGGCCCTTCCTGGCA
CCTTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGAATCCTGCTGGATGCATGTGCA
GGGAGGGGGTTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCTGAAGAGAGGT
GATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGTCTAGGTGAGGGTTTT
GGAAGAGGATGCTGGGATCCGGAGGTCCCCAGGAGAGCCCCTATATTTTTGGCCGGAGAC
CTGGAGGGCGTGAAGGGCATCTTGGGGGTGCCCGACCCTGTCTCTGAGCTCCTCCATGAG
GCAGCCTGGGCTCCCTGTGCGGGCTTGGTGTCGGCCCTCCAGTTCCCCAGGTTGAGGCAC
AGTGGAAGCTCGTTTCTGAGCCCCGTTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCCACA
TGGGAGGGCCCCCTGGCATTCACTGGCATAGGTGAGTGGCTTGTATCATGGGCCTTGAGC
CAGGCCGCGTGGGGTCGTCAAGGGTCAGCCTTTGGGAAAGAAGGGTTCCTCAGGGAGCCA
ACCTGAATCCCCACTGGGAAGAGATGGGTTCTCCAGGAGGGTGGCTTCCTGGGGAACAGG
AACCAAGGGGGATGCCTTCCCTGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTGACA
TTGGTCCAGGCAAGAAAGGATTCCATTAGTCCCACGCAGGGCAGCTCCCAGCTGAGACTG
GGCGCTAGGGTCTGGCCTTGAGGACTGCCCAGGCCACATGAGGGTGGCCCCAGGCTGTGA
TTTTCAGTGCGTGCTTGGAAAGGGAGTCTGTGCACCCTCCCCATGCAGGGGCAGGCTGTG
CGTCTGCCAGGTCTACAGTGGCGCCTAGCTTCAGAGCAAGCCTCCTTGGTTTGCCTGAGC
TGGTTGGTGATCCTGGCTCCTACCCAGGGGTCACAGTGCAGCCCAGGAAGTGCAGGGAAG
CTGGCTTGGACAGTGGAGGTGCTCCAGGGGCCTGCGGTAGGGCACAGCCTGGGCATCTTG
CTTGAGCCTAGTTACTCGGCTGTCCTGTCCTTCCAGGGTTCAGTGGTGGGTACAAGGGTT
CCCCGGGTCCATAACTGTCCCTATTTCACATGGATCCCATCACATGAGTCCATGGAGGTA
GAGCATGTGTAGCCAGCAGCCCCTCCCTGCATTCCTGCATGGAATCTTAAGACCCTGTTT
GGACACCTTTCCCCTGTCCCTCCAGATGGTGAGCACAGAGGAAGAATTGCCTTGAGCCCT
TTGGCCCTGGACCAGTGTCTGTCAATCACGTGCTCAGACTCCCGTGTGCTAAAGCTTAGG
TCCTTCCTGTCATCCTGGTCTCCTGCACTGAGGTATGGTGAGCCCATCCGGGTCCCTCTG
GATATGTGAGTGGGGATGGGGGTGTCCTGGGTTGGGTCGATGATGAGAACCTTATATTGT
CCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACTT
AGGTGAGAATTTTGAAAGAGGATGCTGGGAATCACAAGGTCCCTGGCAGGACCACTGTAT
TTTAGGCTGGAGACCTCAGGGCCCTGAAGGGCATCTCATGGAGGGGTGCCCAACCCTGTC
TGTGCTCCTTCATTAGGCATTCCAGGCTTCCTGTGTGGGCTTGGTGTCCGCGCTAAGCTT
CCCCGGGCGGGGGTGGGACACATTGGCGGCTCCTTCCTGAGTCAAATTCTTCTCGGTGTC
TTTCAGTGAGCTCTTCCCACCAGCAGACCCCCTGGGATTGACTGGCATAGGTGAGTGGAT
ATGCTCGTGTCATGGGCCATTAGCCAAGCAGCATGGGGTCCCCGAGGGTCAGCCCTCAGG
CCACCTGGGTTTCCTCAGGAGCCGATCTGAATCCCGACTGGGGATGTGTTCTCCAGAAGG
GAGGCTTCCTTGGGAAGTGGACACAAGGCAGAGGCCTTCTCTGAAGCTCTGCAGGGGTGG
CAGTGGTCCAGGCAGGAAAGGGTTTCCTCAGCCCCACCCAGGGCAGTGGAGCTGGGCAGT
GCCCAGCTCAGCCTTGGTGCTCAGGTCAGGCCTCTAGGATGGCCAAGCCACATGACAGGG
CCACAAGGGCTCTGGGGCACCATGGGCATCTCACAGGGGCTCTCCAACCCCAGAGAAGGG
TGGGCAATTTGGCCCGTTGGGTCGGGCCGTGGAGATTCAAGGATTGCACCAAACCCATGA
CCCTCAATGGGACCGACCCTGTTAAGCAATGGGCCCTCCCAGTAACACCTCTTTGAGCCA
TGTGGGGGTGGCGCTGTTTCTCTGAGGTAGGGTCCAGACTAGCTCTGGCCAGTCGCTGAT
GGTGGTGCAATCCAGCCATGAGACTTGTGGGCTTTGGGCCAAGGGTGCAGCCCGTGTCCC
GCTGGAGGGTCACCCTTTCCTTATGGGTGAGTGGCGGGGAGGGTATCCTCCTGAGGTGGG
AAAGCCTGCTGTGGAAGGAACTTTCCTGGAAATTTGCACTCCAGGCTGCTTCTGAGCCAT
GAGGTCATCTCCAGGGTGGCGGTGTCTTGGGCCCAAGGAAAGGAGAAGACACCATATGTC
TCCCGGTTGACTGAGTGTGGCCCCGCTCTGTGTGTGGGAGGTGTTGTGTGGGGCATGGAT
TGGGACCCACCAGAGAAAGCTTGTGGCCCTGAAGCCCCAGGCTGCGATTTCCAGTGCACC
TTGAGGAGAGGCCTGGGTGCTTGCCCTCCATGCACAGGGCAGGCTGTGCAACTTCCGGGT
TGGCAGTGGCGCATGGCGTCCGGGCCAGCATCCTGGGTTCGCTGTGAGCTGGTTGGTGTC
CCTGGCCCCTGCCCAGGGGTCCCGGTGCCGCCCGGGGTCATGAGGAAAGCCAGCATGGGC
GAGGGAGGTGCTTGAGAGGCCTGCAGTAGGGCACAGCCCGGGTGTCTTGCCCAAGCCCAG
GAACCTGTCGGCCCTGTCCTTCCATGGTTCAGTGGTTGGGGGGCAAAGGGTCCCCCACGT
CTGAGACACATCAGTGTTTCACATGGATCTCATCACATGGGTCCACAGAGAGAGAGCAAG
TGTGAGCTGGCATCCTCCACCCCCTTCCCTGTCTGGAGGCCTGAGCCCCTGGTTGGACAC
ATGTCCTCCCGTCCCCCCAGGTGGTGACCCCAGAGGAAGACTTGCCTTTGGGTCGCTGGC
CCCAGGCCGGTGGTCATCATCCAGGTGCCCAACTTTGGTGCACTAAAGCTCAGGCCCTTC
CTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTCCCATTGGATGCG
TGTGTGGGGAAGGGGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAA
GAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGGGA
GAATTTTGGAAGAGGACGCTGGGATCCCATGGTCCCAGCAGGGCCACGGTATTTTGGACT
GGAGACCTGGAGGCCCTGAAGGGCATCTCAGGAATGCCCAACCCCGTCTCTGCACTCGTC
CTTGAGGCAGCCCCAGCTCCCTGTGTGGGCTTGGTGTCGGCCCTTCAGTTCCCCATGGGC
GGCGCATATTGGAGGCTCCTTCCTGAGCCCCGGTTCTCCCGTGTGTCTTTCAGTGAACTC
TTCTGTCCACACGAGCCCCTGGCCTTGAGTGGGATAGGTAAGTGGATCCTGCTGGGGCCA
TGGGCCATGAGCCAGGCAGCTTTGGGTCACTGAGGGTCACCCTTCAGGCCAAGAGGGATT
CCTCAGGGACCCAACCTGAAACCACCAGGGATGGATGGTTTCTCCAGAGGGCAGCTTCCT
TGGACATCTGTCCCTAGAAGGACGCATTCCTTGGAGCTATGCAGAAATGATGGCGGTCCA
GGCAGGAAAGGGTTCCTTCAACCCAACACAGTGCATGTCCTAGCTGAGACTCATTGCATG
AGTCAGGCCTGAAGGACTTCCCAGGCCACATGAGGGGGTCTGCAGTATCTGCGGGGGCCA
CAGGTGTTATGCGGGAGCTCTTGGTGCCCGAGGCTTGTGGAGGGGTAGGGTGAGGGTGAT
CAGGCTTATGGAGTTGGGCTGTGAAGATTCAAGGATTGGTCCCAACCCATGGCCCAGAAT
GGACCGACATTGTTGAGCAAGTGGCCATCCCAGCAGTGCCTCCTTGAGCCTGGTTGGGGC
AGTGTGGCCTCAGTGGGGTTGGGTCAAGGCTGACCTCTTGCCTTCACCTGGTGGTGCTGC
AGACTGGCCCTGGGAATCGTGGGCTTTGGGCCAAGAGTGCAGCCCGCAGCCCGCTAAAGG
TCAGCCCTCGTTGAAGTGGAGTGGCCGGAAGAGTGGGATCGTGTTGGGGAAGTCCCACTG
TAAAGGGTCCTGTCCTGGCAATTTGCTGCCCTGGATGCTTCTGAGACATGGGGTCACCGC
CAGGGTGGCATGTTTTTGAGCCGAAAGAAAGGAGAGGACATCATGTGTCCCCTGATTGGC
CGAGTGTGGCCTGGCTCTGTATTTGGGAGGCGTGTGGTACATGAATGGGGACCCACCAGA
GAAGACACATGGCCCTTGGGACCCAGGATGTGATTTCCTGTGTGAGCTTGTAGAGGTCAC
CTGGATGGGTGCATTCCATGCCCAGGGGCAGGCTGTGTGAGTGCCACATCTGCAGTGGCA
CATGGCATCCAGGCCAGCCTCCTTGGTTTGCCATGAGCTGGTTGGCCCTGACCCAGGCCC
AGTGGTCCTGGTGCGGCCCTGGGGTCATGTGGGGGAACCGATGTCGGCAGGGGAAGTGCT
CTCTGGGCCTGCCGTAGGGTGTGGCCCATGGTAGGGTGCGGCCCGGGGGTTCTGGTCTGA
GCACAGTGACCCACCTGCCCTGTCCTTCCAGGGTTCGGCGATGGGGAGGGTCAAGGGTGC
CCTGCGTTCATGATGAGTCCGTGTTCCCCACAGATCTCATCACATGGGTCCATGGAGGGC
AAGGATAGGTGAGCTGGCACCCCCTGCACACTTCTCTGTGTGGAGTGGTGAGGCCATTTG
GACCCATGTCTTCCACCTGTCCCCTCAGATGGTGAGCCCCGAGGAAGAATTGCTTTGGGC
CTCCTTGCCCCAGGCCAGTGTCCATCAGCCAGGTGCCCAGCCCCCGGTGCACTGACGCTC
AGACCCTCCTGGTGTCCCAGTCTCCTGCACTGAGCTGTGGTGAGCCCATCTGGGTTCCTG
TGATGACTTTGCAGGGAGGGGTTTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTG
TCTGAAGAGAGGTGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCT
GGGTGAGAATATGGGAGGAGGATTCTGGGAATTACAAGTTCCCCGGCAGGAGCACTGTAT
TTTGGGCTGGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAACCCTGTCTCTGC
GTTCCACCGTGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTCAGCCCTCCCATTACC
TGGGGGCAGGGTACTTTGGTGGCTCCTTCCTGAGCTCCCATTCTCCCCTGTGTCTTTCAG
TGAGCTCTTCTGCCCAGCAGACTCTTGGCATTGACCAGCATAGGTGAGTGGATCCTGGCG
GCATCATGGGTGATGAGTCAGGCTGCGTGTGGGGTTACCAAGTATTAGCCTTCAGGCAGG
AAGGTTTCCTCAGGGAGTTGACCTGTATTTTCACTGTGGCGAGATGGGTTTGTCCTCTAG
GAAGGCAGCTTCCTGGGGGATCAGACCCAAGACGATGCCTTCCCTGAAGCCCTGCAGGGG
TGACAGTGGTCCAGTCTGGAAAGGGTTCCTTCAGTCTCATGCAGGGCAGCTCCCAGCTGA
CACTTCCTGTGCAAGTCTTTCCTTGAAGACTGCCCAAGACAAATGAGCGGGACAGCAGAG
GCTCTGGGGTGGCACAGGGATCACACGGGGACTCTCCCTCCCCAGAGAGGGGTGGGCAAT
CAGGCCCATGGGGTCAGGTTGTGGAGACTGAAGGATCACACCCCACTCATGGCACTAAAT
GCGAATGACCCTTTTGAGCAATGGGCCACCCCAGTGGCGCCTCCATGAGCCTGGTGGGTG
GCGACTCGGCTTCAACTGGTTGGGTCAAGGCTGAGCCATGCTGGTGCTTCATGGTGCTCC
GGGCTGGCCCTGGGATCATGGGCTTTGGGTCAAAGGTGCAGCCCACCTGCTGCTGGGGGT
CACCCTTTCTTCGAGGTCAATCCTGGGAAGCGTTGCTTCCCCAGGTTGGAAGGCCCCCTC
ATGAGGGACCTGTCCCAGGAATTTGTTGCCCAGACTGCTTCTGAGCCATGGGGTCACCTC
CAGGGTGGTAGGGTCTTGGGCCCAAGGAAAGGAGGGGGCACCATGTGGCTCCTGATTGGC
CAAGTGTGGTCCAGCTCTGTGTTTGACAGGGGTCTGGGATGTGGATGAGGACCCAGCAGA
GAAAGCATGTGGCCCTGGGCCCCAGGCTGCGATTTCTGGTGCGTGCTTGGAGAGGGAGCC
TGGGTGGGTGTCCTCCCTGTACTGGGGCAGGCTGTGGGACTGCCAGGTCAGCGGCAGTGC
CTGGCATCCGGGCCAGCCTCCTTAGTTGGCCGTGAGCTGGTTGGTGACCTTGGACCCTGC
CTAGGGGTTCTGTTGTGGTCCAGAGTCATGCAGTGGAGCCACCATAAGCAGTGGAGGTGC
TGCAGGGGCTGCTGTATGGCACAGCCTGGGCATCTTGCCTGAACCCAGTCTCTCGCCTCC
TCTGTCCTTTGAGGGTTTGGTGGCAGAGAGGGCCAAGGGTTCCCTGGGTGCATGACTGTC
ATTATTTCATATAGATCCCATCACATGGGTCCATGGAGGGAGAGCATGTGAGCCCCAGCA
CCCCCTCCTCACTTTCCCGCACAGAGGCATGAAGCCCCATTTCGACATCTGTCCCCTGTC
CCTCCAGATGGTGACCCCAGAGGAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTGACCAGCATAGGTGA
GTGGGTCCTGGTGGCATCATGGGTGATGAGTCAGGCTGCGTGGGGTCACCAAGTATTAGC
CTTCAGGCAGGAGGCTTTCCTCGGGGAGTCGACCTGAATTTCCACTGTGGAGAGATGGGT
TTGTCCTCCAGGAGGGTGGCTTTCTGGGGAATCAGACCCAAGACGATGCCTTTCTGAAGC
CCTGCAGGGGTGACAGTGGTCCAGTCTGGAAAGGGTTCCTTCAGTCTCATGCAGGGCATC
TCCCAGCTGACACTTCGTGTGCAAGTCTTTCCTTGAAGACTGCCCAAGACAAATGAGCAG
GACAGCAGAGGCTCTGGGGTGGCACAGGGATCACACGGGGACTCTCCCTCCCCAGAGAGG
GGTGGGCAATCAGGCCCATGGGGTCAGGTTGTGGAGATTGAAGGATCACGCCCCACTCAT
GGCACTAAATGCGAATGACCCTGTTGAGCAATGGGCCACCCCAGTGGCGCTTCCATGAGC
CTGGTGGGTGGCGACTCGGCTTCAACTGGTTGGGTCAAGGCTGAGCCATGGCTGGTGCTT
TGTCGTGCTGTAGTCCAACCCTGGGACTCATGGGCTTTGGGTCAAGGATGCAGCCCGCCT
GCTGCTGGGGGTCACCCCTTATTCGAGGTCAGTGGTGGGAACGGTCATGTCCCCAGGTTG
GAAGGCCCCCTCATGAGGGACCTGTCCTGGGACTTTGTGGCCCAGGGTGCTCCTGAGCCA
TGGGGTCACCTCCAGGATGGTGGGGTCTTGGGCCCAAGGAAAGGAGAGGGCACTATGTAG
CTCCTGATTGGCCAAGTGTGGCCCAGCTCTGTGTTTGACAGGGGTCTGGGGTGTGTGTGA
GGACCCCCCAGAGAAAGCACGTGGCGCTTGACCCCAGGCTGCGATTGCTGGTGCGTGCTT
GGAGAGGGCGCCTGAGTTGGTGTCCTCCCTGTACAGGGGCAGGCTGTGGGACTGCCAGGT
CGACAGCAGTGCCTGGCATCCAGGCCAGCCTCCTTACTTGGCCGTAAGCTGGTTGATGAC
CTTGGAACCTGCCCAGGGGTTCTGCTGTGGTCCAGAGTCGTGTAGTGGAGCCAGCATGGG
CAGTGGAGGTGTCACAAGGGCTGCTGTATGGCACAGCCTGGGCATGTTGCCTGAACCCAA
TGACTCGCCTACCCTGTCCTTTGAGAGTTTGGTGGCGGAGAGGGCCAAGGGTTCCCTGGG
TCCATGATTGTCGTTATTTCATATAGATCCCATCACATGGGTCCATGGAGGGAGAGCATG
TGTGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCCTG
GGTCCTGGTCTCCTGCATTGAGCTTGGTGAGCACATCTCGGTCCTGCTGGATACGTGTGT
GGGTAGGCGGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTTTATTGTCTGCGAGAGGT
GATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGGGAGAATTTT
GGAAGAGGACGCTGGGAAACATGAGTTCCCCGTGAGATCCACTGTATTTTGGGCTGCAGA
CCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAACCCTGTCTCTGCACTCCTCCGTGAG
GCAGCCCAGGCTCACTATGTGAGCACTCCTGTTACCCAGGTGCGGGGCACTTTGGTGGCT
CCTTCCTGAGCTCCCATTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGCAGACTC
TTGGCATTGACCAGCATAGGTGAGTGGATCCTGGCGGCATCATGGGTGATGAGTCAGGCT
GCGTGTGGGGTTACCAAGTATTAGCCTTCAGGCAGGAGGGTTTCCTCAGGGAGTTGACCT
GAATTTCCACTGTGGAGAGATGGGTTTGTCCTCTAGGAAGGCAGCTTCCTGGGGGATCAG
ACCCAAGACGATGCCTTCCCTGAGCCCTGCAGGGGTGATAGTGGTCCAGTCTGGAAAGGG
TTACTTTAGCCTCAGGCAGGGCAGCTTCCAGCTGACACATGGTGTGTGAATCTGTCCCTT
CCCCAGAGAGGGGTGGGCAGTTGGGCCCATGGGGTCAGGCTGTGGAAATTCAAGGATCAC
ACCCCACTCATGGCCCTCAATGCGAATGACCCTGTTGAGCAATGGGCGACCCCAGTGGCG
CTTCCTGGAACCTGGTGAGTGGCAGCTTGGCTTCAACTGGTTGGGTCAAAGCTGAGCCAT
GGCTGGTGCTTCATGGTGCTCCAGGCTGGCCCTGGGATCATGGGCTTTGGGTCAAGGGTG
CAGCCCGCCTGCTGCTGGGGGTCACCCTTTCCTCGAGGTCAATGGTGGAATGGGTTGCGT
CCAGAGGTTTGAAGGCCCCCTCATAAGGGACCTGTCCCAGGAATTTGTTGCCCAGGCTGC
TTCTGAGCCATGGGGTCACCTCCAGGGTGGCAGGGTCTTGGGCCCAAGGAAAGAGGGGGG
CACCATGTGGCTCCTGATTGGCCAAGTGTGGTCCAGCTCTGTGTTTGACAGGGGTCTGGG
ATGTGGATGAGGACCCAGCAGAGAAAGCATGTGGCCCTGGGCCCCAGGCTGCGATTTCTG
GTGCGTGCTTGGAGAGGGAGCCTGGGTGGGTGTCCTCCCTGTACTGGGGCAGGCTGTGGG
ACTGCCAGGTCAGCGGCAGTGCCTGGCATCCGGGCCAGCCTCCTTGGTTGCCCGTGAGCT
GGTTGGTGACCTTGGACCCTGCCTAGGGGTTCTGTTGTGGTCCAGAGTCATGCAGTGGAG
CCACCATAAGCAGTGGAGGTGCTGCAGGGGCTGCTGTATGGCACAGCCTGGGCATCTTGC
CTGAACCCAGTCTCTCGCCTCCTCTGTCCTTTGAGGGTTTGGTGGCAGAGAGGGCCAAGG
GTTCCCTGGGTGCATGACTGTCATTATTTCACATAGATCCCATCACATGGGTCCATGGAG
GGAGAGCATGTGAGCCCCAGCACCCCCTCCTCACTTTCCCGCACAGAGGCATGAAGCCCC
ATTTCGACATCTGTCCCCTGTCCCTCCAGATGGTGACCCCAGAGGAAGACTTGCGTTGTG
CCCACTGGACCCAGGCCAGTGGCCAGTAGCCAAACACCTGTTGAGCTGAAGTTCAGGCCC
TCCTGGGTCCTGGTCTCCTGCATTGAGCTTGGTGAGCACATCTCGGTCCTGCTGGATAGG
TGTGTGGGGAGGGGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCTGAAGA
GAGGTGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTGGGTGAGA
ATTTTGGAAGAGGATGCTGGGAAACATGAGTTCCCTGTGAGGTCCTCTGTATTTTGGGCT
GGAGACCTGGAGGCTCTGAGGGCATCTAGAGGGTGCCCAACCCTGTCTCTGCGCTCCTCC
GTGAAGCAGCCCAGGCTAACCACGTGGGCTTGGTGTCAGCCATCCCCTTACCTGGGGGCA
GGGTACTTTGGTGGCTCCTTCCTAAGCCCCCATTCTCCCCTATGTCTTTCAGTGAGCCCC
TCTGCCCAGCAGACCCCCTGCAGTGACCAGCATAGGTGAGTGGGTCCTGGTGGCATCATG
GGTGATGAGTCAGGCTGCGTGGGGTCACCAAGTATTAGCCTTCAGGCAGGAGGTTTTCCT
CGGGGAGTCGACCTGAATTTCCACTGTGGAGAGATGGGTTTGTCCTCCAGGAGGGTGGCT
TTCTGGGGAATCAGACCCAAGACGATGCCTTCCCTGAAGCCCTGCAGGGGTGACAGTGGT
CCAGTCTGGAAAGGGTTCCTTCAGTCTCATGCAGGGCAGCTCCCAGCTGACACTTGGTGT
GCAAGTCTTTCCTCAAAGACTGCCCAAGACAAATGAGCAGGACAGCAGAGGCTCTGGGGT
GGCACAGGGATCACACGGGGACTCTCCCTCCCCAGAGAGGGGTGGGCAATCAGGCCCATG
GGGTCAGGTTGTGGAGATTCAAGGATCATACCCCACTCATGGCACTAAATGCGAATGACC
CTGTTGAGCAATGGGCCACACCAGTGGCGCCTCCATGAGCCTGGTGCGTGGCTACTCGGC
TTCAACTGGTTGGGTCAAGGCTGAGCCATGGCTGGTGCTTTGTCGTGCTGTAGGCCGACC
CTGGGACTCATGGGCTTTGGGTCAAGGATGCAGCCCGCCTGCTGCTGGGGATCACCCCTT
ATTCGAGGTCATTGGTGGGAAGGGTCACGTACCCAGATTGGAAAGCCCCCTCATGAGGGA
CAGGTCCTGGGAATTTGTGGCCCAGGCTGTTCCTGAGCCATGAGGTCACCTCCAGGATGG
TGGGGTCTTGGGCCCAAGGAAAGCAGAGGGCACTATGTAGCTCCTGATTGGCCAAGTGTG
GCCCAGCTCTGTGTTTGACAGGGGTCTGGGGTGTGTGTGAGGACCCCCCAGAGAAAGCAC
GTGGCGCTTGACCCCAGGCTGCGATTGCTGGTGCGTGCTTGGAGAGGGAGCCTGGGTGGG
TGTCCTCCCTGTACTGGGGCAGGCTGTGGGACTGCCAGGTCAGCGGCAGTGCCTGGCATG
CGGGCCAGCCTCCTTAGTTGGCCGTGAGCTGGTTGGTGACCTTGGACCCTGCCCAGGGCT
TCTGTTGTGGTCCAGAGTCATGCAGTGGAGCCACCATAAGCAGTGGAGGTGCTGCAGGGG
CTGCTGTATAGCACAGCCTGGGCATCTTGCCTGAACCCAGTCTCTCGCCTCCTCTGTCCT
TTGAGGGTTTGGTGGCAGAGAGGGCCAAGGGTTCCCTGGGTCCATGACTCTCATTATTTC
ATATAGATTCCATCACATGGGTCCATGGAGGGAGAGCATGTGAGCCCCAGCACCCCCTCC
TCACTTTCCCGCACAGAGGCATGAAGCCCCATTTCGACATCTGTCCCCTGTCCCTCCAGA
TGGTGACCCCAGAGGAAGACTTGCGTTGTGCCCACTGGACCCAGGCCAGTGGTCAGTTGC
CAAACCCCTGTTGAGCTGAAGTTCAGGCCCTCCTGGGTCCTGGTCTCCTGCATTGAGCTT
GGTGAGCACATCTTGGTCCTTCTGGATAGGTGTGTGGGGAGGGGGTGCCCTGGGTTGGGT
CGATGATGAGAACCTTATATTGTCTGAAGAGAGGTGATGACATAAAAATCATGCTCAATA
GGATTACGCTGAGGCCCAGCCTGGGTGAGAATTTTGGAAGAGGATGCTGGGAAACATGAG
TTCCCTGTGAGGTCCTCTGTATTTTGGGCTGGAGACCTGGAGGCTCTGAGGGCATCTAGA
GGGTGCCCAACCCTGTCTCTGCGCTCCTCCGTGAAGCAGCCCAGGCTAACCACGTGGGCT
TGGTGTCAGCCATCCCCTTACCTGGGGGCAGGGTACTTTGGTGGCTCCTTCCTAAGCCCC
CATTCTCCCCTATGTCTTTCAGTGAGCCCCTCTGCCCAGCAGACCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved