Macaca_mulatta Locus Poly:19:SNORND104
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:19:SNORND104
Macaca_mulatta
Poly:19:SNORND104
16
SNORA76
1258..1390
2390
TTTCCAAGGAAAACAGGGAGGCAATAAAGATTACCAGCGACTGTGACTGCTGGTGTACT
GTGTCCCCACCCAGTTAAGCAAACTCTCATTCAGCCACCCGTATTTCCAGTGAATGGGCT
CAATCAACTCTGCGAAACTTTCCCAAAGTTTCTGTCCTTTCTGTCCTTTGGGCTTCTACA
GTAGGCTGTTCATAGCTCTATTTTAGTATTTATTAACGTTTTGCAGTCCCAGGAAGTTTT
CCACATCACCCTGCCCTTTGAAAACCTTTGTTTACCACTGAGAACGTGCCAGGCAATTGG
AATTAATTCACCTAATCCTTACAACTTTTTTTCCCCCCCGCGGTGTGTGTGCGGGGGTGG
GGGGGAGGGAGCCGGGTATTCCTAATTTCCAGAAATTGAAGCTCAGAAAGGTTAACTGAG
CAAGGTCACAGAGCGAACGCATCACAAAGTCAGGATGTGGTGCATTTCGGTCCACTTTCA
ATATAAGCTCTTTCTACCACAACAGGTTACTTTGCACTCGGGGACAGTTTTCAACTTTAC
ATTCTCAACTCCTATCCTAGCTCCTGGCACAGAACATGTCATTCAAGTTAGGCATCATTT
GTCCCCTGCTCTTGGTAAAGTTTTCTTTTGCGGACTGCAGAGAAATGCGCTCATTAGCAA
GTGGAGATCGAGACGCTGAAACGCAAAGGATTTGAGACTGAGCGGCTCCCATCTCTATGG
TTGGTATGTGATCCATCTATCCTCTGGAGGATTCAGCAAGGACTATCAATCACCAGACAA
CTTTACTGCACGTGCTCGCAAGTTGAACTTGCTATTGGTTAGTGGCAGTAAAGCCCGCCT
ACCAGCTCTGGTCGGCTCCTTTAAGAGAAAGCCATCGCCATTCTTCAGCCTTTCACCGCC
TACAGATTCCGGGAGGTGAGGTTGTTTGCCAGGCGGGCCGTGTGGCTGGGTGGGCACCGG
GGCTCGGGGCCCGGGAGCAGGGAGGCGGGGGAGGCCGGCCTGCTGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACGCTGGTGATGCGAACTGGAGTCTGAGCCGGCCCGAG
CAAAACAGGGAGGGGCCGGCGGGCGGGCGAGCGCACACCGGCTCATCCATCACTCTCCTT
TTCTTGTAGCTCCCAGCCGAGGACGTCGGGTCTTATCGTCCTTGCTGTTTTGCCACCCCA
TTCCTCTCAATAAAGTGGTTTGAACCCAACCCTGGTGTCGGTGTGTGTTGTTGGCGGCGC
GCTGTCTTTGAGCCCCCGCCGAGCCTCCTCGTGGCGCCGGGGGTCAATCTGCAGCGCTAG
AGCATGTGCTTGCGCATAACTGGGGCCGCTTGGCCCCCCGCGGGCGGCCCTTTTAACCGC
GAGCGACAATTAGTAACCTGACTGTCCGGCTGCTAGGCTGGGCAATTTTCCAGGGATTTT
GCCACGACAGGCCTCAACCCGTAATACCAAGGCTGGAATGGCGTGTGAGGGGGACGGTGT
CTGACGGGGATACGCGGACTGCTGCGTAGTGAGTGCCCCTCTGTGCTCCCATGCGTTCCC
CAGCCCTCCCCGAGTGCATCGCGCGCGTTGTGCCTTTGCCATGAGTTCGACATAAGTCCC
AAGCTGTCGTGTCTGCCATCAGACGCGCAGATTTAGTTGAAGGCAGCTTGGAATGGCGTC
TGCAGGGCTGCTGTGTACTTGACATAAACGGATTCAGTGTGGAACTGCATGAGTTAACTC
CTGACTAAAAGGGTAATCGACCTGTTTACAAACAACCACCATGCAGGAGTACGTGTGACA
AGCATGGGACTAAAGCTTCGGGTTAGGTTAATCTGTCACTCCTAAACAGTTAAAAATTAT
AGGGCGGTTGTGAAGATGAATTAGGTTTTATATATAGTTGGGGACAACATAGACACCTAG
TTACAGTCCAGATTCTATGGTTGGTAAAAGATCTTACACAAGGGCTCCAGTGAAATGTGC
ATCAGTTCTGAGTACGAGGCAGCAGTGGTGGGCAAGGATGCACGTATGCGCTCACTACAT
GGGCATTCGATGAATGAACGTGTCCCGAATGAAGATAACTAGACGATGAAGGGTATAAAC
TGCAGCCCAGGAGCACCACTGCCCTACCCCCTCAGTTACGAACTTTCACTGGATTCTTTA
AATGTGGGCTGAAGATAATGGCACATAATTTGAAGGGATGTGGTGAGGATGGCTTTGCAG
CCTTAGGACTGGGCAGTGATCCAAACCAGTTAAGTGAAAGCTGCCATTGCCAGGTGAGGG
CCCCGGTGCTTGGTACTCACTTGTGCCCCTATCTGAACAGGATTCAGTAGAAATGACTTA
GATGCTTATCTAGTATTTGACATGAGATATTTATTTTGTGAAACAATGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved