Macaca_mulatta Locus Mono:55:SNORA42
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:55:SNORA42
Macaca_mulatta
Mono:55:SNORA42
7
SNORA42
1001..1136
2136
AATGGGAGAAATCAGTTTAGCTGACTTCCTGACTTACTGTGTTACAGTCATTAAGATTG
TGTGGTCTTGGTGGATGCATAGGCCTATAGATCAATGGGACAGAGTAGAAAACCCACAAA
TGGACTCCTACAGATATGCACAACTGATTTTTTTAAATAAAAATCCAAAAAGTATTCAAT
GGTGTAGGATGGCCTTTTCAAACAATTGCTGCTGAATCAATTGTACATCCCTTAGCCAAA
AAAAGAACCCTGACCTAAGTCTTGCATCCTATAAAAAATGACTTAAAATAATAGTTTGTA
GACAAATGTAAAATATAAAACTATGAAACTTGTAGAAAAAAATAGGAGATCTTTGGGATT
TAGGGCTAGGCAAAGCATTCTTAGACTTGACACCAAAAGCACTATTTGTACAAGGAAAAA
TAGGTAAATTGGACTTCATCAGAATTAACTTTTTTTCTCTTCAAAAGACCCTGTTAAGAG
GATTAAATACAAGCCACAGACTCGGAGAAAATATTTTGCAAAACACATATCCAGCAAAAA
ATTAGTATCTAGAATACATAATGAATTTTCAAAACTCAATATAAAAAAATCTAACTGGAA
AGTGGGCAAAACCATTAATAAACATTTCACCAAATAGGATATGTAGATGGCAAAGAAGCA
TATGAAAAGATGCTCAACATCATTAGCTGTTAGGGAAATGCAAATTAAAACCACCATAAA
ATATTACTACAGAATGGTTAAAATAAAATAATAGTGATAACACCAAATGCTAGTAAGGAT
GTGGAAGAGAAATAGGATCGTTGATATATTGTTTTTGGGAAGGTAAAATGGTACAGATGT
CTAGAAAGCAGTTTGGTAATTAGAGAAAAATCCAAAGTATGCATGCAGTTCTGTAAGATA
AAGTGTCCGGGCATGCATACAACCCAGCAATTGCATGCCTGGGTGCTTATCTTACAGAAA
TGAAAATTTATAATTACATTATAATTTGTACACAAAGGTCATCACAGCTTTATTAATAGA
AGCCAAACTCTCTGTGGGCTTCTCACAGTGTACTCATGCCAGAGTAAACTGCAGCCTTGA
ACCATTGCTCAGCCGCCTTACCTGTGAGCTATGAATACTGAAGCAGGTTGCACAGTGAAA
AAACCAAAAAGCTCAAACAGGAAACACTCTGGATATCCTTCAGTGGGTTAAGAAAACTGT
GGTACATCCATAGATGGAATACTAATCGCCAGTAAAAAGGAAGTAACTATTGATATATGC
AACAACAATGAATCTTAAGATAATTATGCTGAAAAATCCAATTCTAAAAGATTACATACT
GTGTAATTTCATTATATAACTTCCTCGAAATGACAAAATTATACAAATAAAGAATAGAAT
AGTGGTTTCCAGGTTTTCAGGATGGGGGTTAGGATGAGTAAGACTTTAAAGGACAAGATG
GATCCCTTATGATGATGGAAATGTTTTGTAGCTTGACTGTTTCATGTCAACATGTTGTTT
ATGATATGGTACTATGGTTTTGCATGATATTGTCTTTGGGCTAAACTGGATAAAGGGAAG
ATGGGATATCTTTGTATTATTTCTTAAAACTGCATGTGAATCTACAATTATCTCAAAATA
AAAAGCCTGATACCAAAATTGCGGTCCGTGGAACAGAGAAAAAAAAGAAAAAAAATTTAG
CCTCAGTTAAAAAGATAATTGTTACATGATGATGTATACAATAAAAAACCTTGTTGCAAT
TGAAATCTGAAACTGTACTGATGACTTCCATACTTTATTATGTTAAAATCTATTGTTTTG
TCTTGTACTTTGAATGGATCTTTTACTCATGCATTATTTCAAATAACATCACACATTAGT
TATTTGGAAAATGTTGTTCATTCAGTTATTTAACTCTTCAAATATTGACACATTTCAGTA
TAATACACAATATCAAAATAGATTATTTTAAAAATTGTCAGAAAAGTTATTTAGCATTGG
GAACCTTGCAAACTCATGGTAAGGGACACACGTTTTCCAAAATTCTAATTTTTGTTCAAA
AGCTCAATTTTTTTCGTTGTCACAAATACACTTGGTTGTTTTGTTTGAAGTGACAAGTTT
GCTTCTTTCCTTTTTAAGAAAAATCTTGCCATATATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved