Macaca_mulatta Locus Mono:249:SNORD81
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:249:SNORD81
Macaca_mulatta
Mono:249:SNORD81
3
SNORD81
1001..1059
2059
AATCAACTGGACCTATGTTAAATGTGGCCTGTATTTAAACCCTTTGCTGAATCTTTATA
CTTTTTCCTTGAAGCTACTGTCTTCCATTAATGAGGAAAGATGTAGGAGAATTCTTATTT
TATACTTGTTTCACTTGGTTGACAGATGTAGGTTGATAATGAGTAAGGAGCCTTTAACAA
GTGAGAAGGGTCCCAGATATGGGCTCTTTCCTTGGCTCTATAAACTTTATTAAATATTTC
TATTATAAGACATGACTTATAAGAAATGTTGATTATCTTCAGGGCTTGTATTTAGCTGGT
GTGACTCTGTATTAACATATTGAAATTATTTGGTACCCTTAAAATTATCCCAAATCCCCT
CCCACACCACTGCTGGGTCCTCCTGACCTCCCCATTATCTAGCAAATTACCTCTAGGTCT
CTTCTGATTGGTTTGGTGTCCATTTCATCTAGTTATTAACTGTTTTTCACATTGTCTCAG
TTCTCTTAATTATCTTGCTTTTCTGTGCTTGAAGATAAGCCAGATTGATGGTAGGGTTTA
CAGAATACTTTTTATAAGTAAGTCATTTTCCATTATGAAAAGAACCTTTTATTTCAAGTA
CTTGTTCCTTTGGAGACCCTACTAATGTAGTCAACAAAGCAAGAAGGAACTAGAAATTAT
AACACATCATGTACCCAGTGCTTCTCCGCCCCTAGCTTCTCATGACAATCCCTTCATTAC
CCTCTCTACTCTCTTGTGCCATGCGTGAGTCCTCTTGCCATCCCACCCCACCATACACCT
GACGCCCAAATTGGTGTTCCTCACTCAGCTTGCCTTACTTGGGACATGCCATGTTTACAC
TTTCACAGATTCCTCCCATTCTTTTTATATACCCCATCCATGACCCAAACTACTTGAAGG
AGAACTCCACTGGGTTCTCATCCTTAGGACCCTGCTTTTGGCATTCAAAGGAATCAATTA
GCTCCACATTTCACTGCTGTAGGGATCATTGATATTACTGTGAGAATGCAAGATTTTCTC
TCACTGATTACTTGATGACAATAAAAGATCTGATATTCTGCATTCCCATGTAGCATTTTA
ATTGAAGTCTGAAAATGTGGCTAAAATCTCTTATTTTTTGAGACAGGGCCTTGCCTCACC
CAAGCTGGGGTGCAGTGGCCCTTTGAGGCTTACTACAGCCTCAGACTTCTGGGATCAAGT
GATCCTCAGCCTCCCAATGTTCTTTGTAGACAGCTTGACGGAGTCTCATGGCACAAGAAG
ATTAAAACAGTGTCTCCAATTTTAATAAATTTTTGCAATCCAAAACAAAACAAAAAAAAA
GAGAATGCAAGATTTGTATCTAGTAAGCTGTGTTTTAACTGTGACATTTTGGAGGCAGAA
TTCTCACCTGTCCTTTGTTAGCCAATCCAAATGACACTCTCAATTGTGACTGCTACAGGC
CTGGATAGTGATGTTGACTGAAGAGGCTGACTGAACCTGGCAGGACCTCCACTGCTCATG
CTTACATCCCATCTGTGTGAAAGTCCTTTCCAGGAGAAAAAGCATTTTCCAAAATTGTAC
AGATATCTCCCAAATGAAGCAGAGCTGTTTAGACCATTATTTAGTGAGTTTAAGAGACTG
TTCACAGTGCCTGCCTGCATGGAGCAAATAATAAATCAGTCTGATTTTAATTTTTCGGGA
TGACTGGATTGGATCCCAAGTCATCACGTTGTTATGGTGTCTTTGATTTGCTTTGGCTCT
AGAGCTACTACTAAGGAATAATCTCTAATCCAGTTGCACTCACCCTTCTCTCAAGTCATC
TTGTGTTCAGTAAGAATATACATTACTCATTGGTATATGGTTTTAAAAGGTTTCAAACAC
CATGAATATATGACTTTACTTCTTGTAGCACAATCCATTAGCCACACCTGACTGCCTGAT
ACTTCAGACCACAAATATTTAAAATCTGCTCACTTCTTGCTCATTTTAATTCATCAAAGA
ATCTATGTTTAAAAATAGAATGTATTTCAGCTTTTGAGTTTTCTGTGAAAGAGCCCTCAT
ATTCTGCCTTGGTCTATATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved