Macaca_mulatta Locus Mono:212:SNORA7
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:212:SNORA7
Macaca_mulatta
Mono:212:SNORA7
14
SNORA7
1001..1138
2138
TATTTACAACAGAGCTCGATGTTGAGGAGGGGCGGACAGCAGGTCACTAACAGCCAGGA
AACACGCTATGGAAGAACAGAAAGAGAAAGAAAAACAAATGTAACTATCAATAGCTTTCC
CTTGCTTATCTGTGTCCTCCAGGAAGCCCGGCCTAATGACCACCAAAGCAAATCTGACCC
ATCTCATAGCCCTGACCAAAGCCGGACCCAGGGTCTGCTCTCAGTGTGCTGCTCATTTGT
CCAAGGCTCCAAATGGTCGAAGGGCCCCAGACAAACACTGTTCAGTAGAGAAATTAGGTC
TTTATTGTTGGTTCCTGGGATCCATCAATGGTCAGTTGTTAGAGGGATGGCTCAGCACAG
GGGTGTCGGTTCTGTGGTTTACTGTCCCAGGGTCTCGCCATCATCTCCAGTGCTTACCCT
GCCCTGTTACTCTCATCTCCCAGGCCCTGGAATTCAGAGTTCTCTAAGGCAGAAGTCATT
TCCTTTTCTTAATATTTCTTCTTCAAACTTGCTGAGAGTGGGGAACAAGTTCCCCCGAAC
CCTCACCAAAATCAGAGAAGAGACTTTTCAATGGTAGGAATGACTCCTCATCAGGGTTGT
GGGCTCTCTGAGGATCAAAAGCCTTCTGCAGTACAGACTAGGCGCTGCCTGAGCTGGGTC
AAGACCACCTGGTTTGGGGTCAACATGCCTCTCTTCTTCTTCCTCAACAGAGCCCAACTG
TGTTTCCTTAAACAGATGAAGAGCTTCCTAGGATGAGAGGCCTGGCCCTGTTTCTTCCTC
TAGACCAATAGAGGGGGAAACTTTGCCTCCCTTGAGGCATTTGGTAAAATCTGGAGACAT
TTCTGTCTGTCAGAACTGTGTGTGGGAGGGGTACTACTGTTATCGGGTGGATAAAAGCCA
GGGATACTGCTAAACATCCCACAACGCACAGGACAGCCCCCACAATGAAGAATTATCCAC
TTCAAAATGTCAAGAGCGCTGAGGTTGAAAACCCTGCTCTAGAGCTTCCAGGATCACCTC
TGCAGAGTGGCTAATATTCTGCCAGCTTCGGAAAGGGAGGGGAAGCAAGCATGGCAGAGC
ACCCATTCCATTCCCAGCTTGCTTAGTAGCTGGCCATGGGAAGACACTCTGCAACACTGT
AGAAAACCCTGCTCTAGGCCAGGCGCGGTGGCTTGTGCCTATAATCCTAACACTTTAAGA
GGCCGATGTGGGTGGATCACTTGAGGCTAGGAGTTCAAGATCAGCCTGGCCAACATGGAG
AAACCCCATCTTTACTAAAAAAAAAAAACCAAAAACCAAAAAACAAACAAAACAAAAATT
AGCTGGGCATGGTGGCACATGCCTGTGATCCCAGCTACTTGCGAGGCTGAGGCACTAGGA
TCACTTCAGCCCAGGTGGCGGAGGTTGCAGTGAGCCAAGACTGTACCAAGGAAACAAAAA
AAAAAAAAAAAAAAGAAAGAAAGAAGAAAGCCCTGCTCCATGGCCTGCCCAGCTTTCCCT
GGCAGCAGGGCAGGAGAAGCCAAAGAAAACTTCTCTAGGAGCCTGGAAATGGACTGATTC
CTATCCCAGCCTCCTCAAAGGGGCACCTCAAGAAGAAATGCACATCACAGTGGGGAGTGA
GACTAGGCACAATTTAATCACAGCCTCAGCATCAACCCACTGGAGCACAGCACAAAGAAA
CAACCCACCATGGCTTGGTAGAAACAGACATGCCAGGCTCTTCACTGAGGAAGAGGAAGA
AAGGCATGGTGACCAAACCAGGCAGGGGTAAGGCAGAGGTATTTATAGTCCTGCAAATAT
CTGTTTGTCAGAGTTGGCCAGCACTGCTGGGGTTCTTAAACCCTTGTACCCGCCTTACCA
CTGGAATCCACCGATGGGTTCTGCAAACCTGTGCCGGATCAGGAAAGTGGCAACAGCTTC
AGCTACCTGGAAAAGGGAGAGATATTCCAGGCCATATGAAGGTTACTGATGGGGCTTAGC
CTTGGGCTGTGGGCTACTGTTAGACGGTTAGGCTCTACAGTGCCCTCATCCCACCCACAG
GTCTGAGCGGCTTGAAATTAAAAGGACCTAGGCCCTCCCTAGCAGAGCTAGGAGACTCTT
CCCCACCATCCTTGCCAGGGATAGCTCCAAAGAGCTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved