Macaca_mulatta Locus Mono:66:SNORA40
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:66:SNORA40
Macaca_mulatta
Mono:66:SNORA40
4
SNORA40
1001..1117
2117
CCAACCATGGTTCCTAGTTGTTTGTAGATTTTGGTGGGTGTGATCATTTTAGAGCACTG
GATTACAATTATGCAAATATTATTCATTACATGCCAAAATGTCTTTTTCATTGTTTCCCT
TTAAGACAGCTAACCTCGGAAAATATCACTAATATGGAGCAGGTGGGGTCTTACCCATTC
CACATAAACAATCTTCTAATAATCACATGAAAAAGCAGATGGATTTTCAAGATGTACTGT
TAAGTGAATGGTGAGTTGCAGAATGATTTGTAACATGATCCTGTTTCCAAGGGGGAAAAA
GTATATATGTGTTTGTATATTTGCTTATTTATAAGAAGTTTGGAAAGATAACTTACCTAA
CTACTAAAACAGTGTTACCTCTAGAGAATGAGATTTGGGAGGGTAAGAAGGAATTTTCAC
TTCTTAGATTTTATTTTTATATTATTTAAATAGTTTAACATTAAACATGTATTACTTTCA
TGATCTTTTTAAACTTAGGGAAAAAAAGATGAAACATTTCATGGTTCCACTTATCAGGAC
TTTGTATTCTTTCTCTTCAATTTAATTCAAACATTTTAGAGTGCTTTTTATGGAGAGCAA
GAGAACTCTGGCTGGGGTGTGTTGAGCAAGGGATGCTTGTGCGATGTCCAGAAGGTTATT
AGAGATAAGGCCTGAGCTCAGGAGAGAAGTGTGGGTGACATGTCGAGGAGTCATCAGATT
CTACACAATAACTAAGATAAAAAGTACTGTTGCAATTATGTACTTACTAAGCAAATAAAA
CCGTGGCTTTCAAACTTTTAATGTCCAAGTCTCACTTCTGATTAGGTTGAGCATTCCTAA
TTGGAAAAATCCAAAATCCAAGATGCTCCAAACTCGGAAACTTTTTGAATTCTAACATGA
TGCCACAAGTGGAAAACTCCACACCTAACACTTCTGCTTTCTAATGGTTCAAGGTACACA
AATTTTATTTCACACACAAAATTATTAAAAATATTGTATACTGCACTGTTTTTAACTTGT
GGACAAAGACTTATGGATAGGTGCAAAAAATAAATCCTCTTTTGCAACCCAGAACTCATT
GTTCAGTATGAGTTTTGATACACGTAAGAAGGGATATTATGATACCTGAGACAGTTAACT
GATGGGAGTATTGATAGCCGCAAAGGTTGGTTCCAAGCCAGGCACAGTGGCTCAAGCCTG
CAATCTCTACACTGAGGCGGGAGTATTGCTTGAAACCAGGAGTTCAAGACCAGCCTGGGC
AAGAAAGTAACAAACACCTCATCTTCACAAAAATTTAAAAATTAGCTGGGTACTGGGGCA
TGTGCCTGTAGTTGCAGCTACTCAGGAAGGGGAGGCTGACGCAAAAGGACTGAGCTCAGG
AGTTAGAGGCTGCACTGAGCTTTGATGGTACCACTGTACTCCAGTCTGGGTAACAAAGAC
AGACCCTGTCTCTTAAAAAAAAAAAAAGACTGATTCTAGGACTGTAAAATAGATAAACAG
CATGGGATATAAGGGAAATCCTCAGCAGTATTAATTTTGCATTACAATTTCATGTTGACG
ATACATACGATGGCTTTTTGTTTTAATGGCTTTTATCTTGAGAACATGATGTCCAGAGTT
AAAGGTACTGGCATATTCCACACATCTGTACTATTCCTGAGTGTGACTGCTTAGGAATGA
ATATGATTTGAACTCATTCATGTTAAGGGAGGGTGTCAAATTGAGAACCAGGCAGATCCA
CACCTACAGTAAAAAGGACCCTAAACTAAACTGGTTGAAGAAATTAGATCCCAAAGATTC
TTGGTGAATTTTCAAGTCTTCATCAGTATATCCATATTAAAAGGAGATGACAGAAGCCAA
AGTAAAAGAATTATGGGCTGACAGACCACTGGATTAAAATAAGCATCAGTTTCATTAAAA
AGGGCTAACTTGAAGGTAAATCTTTTGACTCCAGCTCTTTAGTGGATCTAAAGTGGCCTT
GATGGACAGTGGAAGAAATCACAACATGGAATTCCTTGAATAAAAATGTATTGACTTTAA
AAAAATAACAAATAAAAATTAAAAAAATTGTATAACATTACCTTCAGGTTGTGTGTATAA
GTACATATGAACATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved