Macaca_mulatta Locus Mono:304:SNORD59
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:304:SNORD59
Macaca_mulatta
Mono:304:SNORD59
12
SNORD59
1001..1068
2068
AAGACAAACTTCAAAATGCTCCAAACTTCACTTCATTTGTATTTTACAAGCTTTTTTTT
TTTAAAAAAAAAAGACTTTTTTTTTTTTTTTTGTACTGGAATTAAGCTAGGAGAAAAAGT
TCTGTGAGTCTTCTATTATAAGCTCTCTCCTCAAATGACTACATTAATATTAATAGATGC
TTCATTAGTAATTTCATGTTATGGATTCTAGTGCTTCTCATGTTACTTGACAACATTAGA
AATAATCACTACTGCATATTTTTTTGTCTAATTACTTTGTAAAACATAAGAAGTTAATTT
ATTTTAGATGTAGACAGTAATGGATGTAATAAATATATGACAATTTGTTACAATTTTTTT
ATATGCTTTGAGGAATTGTAACATTTTCTGGTTGAATTTGTCCAGTTTCACAAATTAATG
CCATGATTTAAGTGAATTTAGCATAGTACTCATTATATAAATCAGGAGTAAAAATAGAAG
CTCTCTTGAAACTAAATTTTAATGACTCTTAAATTATAATTTGTTTAGTCTCATTTTGTT
TCATTTCCTTTTTGTTGTCTGGTTTTGTTTGGTTTTCTTGCTTCTACAGAGATGCTGAAT
ACACAAATTATACAAAAAATATTATTTCTGTTGTTGTTGTTTTGTTTTGTTTTTGTTGTT
TTTTTGAGATGGAGTCTCTCTGTCAACCAGACTGGCGTGATCTCAGCTCACTGTAACCTC
TACCTCCTGGGTTCAAGCAATTCTCCTGCCTCAGCCTTACATGCAGCTGGGATTACAGGT
GCCTGCCACCATGCCTGGCTAATTTTTGTATTTTTTAGTAGAGATGGAGTTTCGCCATGT
TGGCCAGACGGGTCTCGATCTCCTGACCTCAGGTGATCCTCCTGCCTCGGCCTCCCAAAG
TGCTGGGATTGCAGGGTTGAGCCACTGCGCCCTGCCAAAAAATATTCTTTATTTATCTTT
ATCAATAGAAAATAAATTAACATCCTAAAAACAGCAGAAAGCCTCACTGATGAGTAGCTT
CTGGCTTTTGTTCTGAGATTACTAAAGCTAGATGCCATTCCAGATAAGAAACAAAAATAA
ATAAATAAAAAGAAAAACAGCAGAAAGTTTTCTTTTAACATTTGAATTTTGTTTATTTTA
ATGGAAATTTTTTAATATGTTGACATTAAATTGCCTATGGTTGAGAGAAAAAAAATCCAA
AGCTCTTAATCATTAAAATCACTGTCTTTATGGATAATTAAGTTAAACTACCCAATATGA
AATAATGAGAATTCAAAGGTATGTATTTAAAAAAACAGGTCTTTTAAAAAATGTAGAAAA
CTTTAGAACTACTATATGTCTGATCTTATGAATGGCTGAAATAATTAACCATATAATTCT
GTAACCCTAATTAACCATGATTTATAGAAAATCAGTAAAATCTCACCTTCCCAAACTATT
TTATGAATGTAATAGAACTTTGTATCAGTGATGAGAAAGAACAGTAATTTATACAAAGGA
AGTTTAATATAAAGAAACATTAACTAGTAATAGAAATTAACTATGAATGGATAAAGAAAA
TTCTGAAGAATAAAAATAAGTTGAGTAAAATGGACATTGTACTTGCAAAATCTTAAACCC
TTCAATTTATTGAAAGAGAACTGTTAATGATAAGTTGTTCTGAAAGCAAGCTTCTATTTA
CCTTTCAGGGCTGGATTTCTCTATAGGCCTATAGACACATGCAGCAAAAGAAATTTCTTC
CAGTCACTTCTTCTGAATGTGTGCTTATAAACTCCTTTTTTGTGTGTGTGTTAAGCTTTT
TCATTTACTGAAAGAAAACTGTTAAGGATGAGCCATCTGAAAGTAAGCTTCTATTTACTT
TTCAGGACTGAGTATCTCTATGGAGACAGAATCATATGGGAAAAGAAACTTCTTCCAATA
ACTTCTTAATATGTGCTTACAAACCCGTTTTCCTGTTAAACTCTCCCATTCACTGGTAGA
AAACAATGAACAGGTACTACTTGTATGATTGAGATAGAGCACCCAAAAGAAAAAAAAAAT
GTAAAGAACCACCCTCCACCTCAAACATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved