Macaca_mulatta Locus Poly:18:SNORD42
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:18:SNORD42
Macaca_mulatta
Poly:18:SNORD42
16
SNORD42, SNORD42
1001..1067, 3604..3664
4925
AGGCCAAGGCGGGCGGATCACGAGGTCAGGAGATCGAGATCACGGTGAAATCCTGTCTC
TACTAAAAATACAAAAAATTAGCCGGGCGCGGTGGCGGACACCTGTAGTCCCAGCTACTC
CGGATGCTGAGGCAGGAGAATGCCGTGAACCTGGGAGGCGGAGCTTCAGTGAGCTGAGAT
CACGCCACTGCACTCCAGCCTGGGTGACATAGCGAGACTCCATCTCAAAAAAAAACACAA
AAAAAACTACAACCCCCATGAAGCTTTAGTGCCTTTGAGGGGAGGAGTGGCGCATGTTTG
TTCACGCACGAAGAAGAAATTAAACCTAACTACCGTTCCCAGAGGGCGCCACTCTGCAAA
TTACCAAATCAGCTCTAAGTACAAAGCATCGCGAGTCTTTGATGAGCTTTGGCGCTATAA
GCCTGTGAGAACGGGCATCGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGA
AGGTGTGTGTTGGGGATGGGGCCGCCGCTGCTTTGCCAGGGATTGCCGCGCCGCAGAGGG
AACGAATTGGGAGCATGGCTGCTGGGCTAAGTCCTGAGGGCTCTGCTCCGGGGTTGCTAC
CCGCTTTTCGGTCACGCTGCAGTATACTTGGGCCGCGTGGGCCCAGCCTCATGGGCTGAG
TTCCGGTGGAGGGAGTTGGGGAGGCAACCCGGCCGACATCATCCGCCAGGGAGGGCCAGA
CATTCGGCTTTGGGAAGCTACACGCATCCGTTGGTTGACGCATCCATGTCCCCGGGCCTG
TAAGAAGTTAGTGCCCTCAGCTTTAACCATTTTTCCTTCTGGTTCATGTTTAACCGGGCT
ACATTACCCGCCCCACTCTCCGCTGCCTGGTTTTGCGATGGGGTATGTGTAAAATTCCTA
GGACATTTTCTGGAAAGTACTAAGCGTTCGTTCAGTGCTACTTTGTTTTATAGTCGTATC
CCTGGACTGACTTCGAGTTGGTCGCTTTCGCCTCTGGTATCGTGCATGTGATGGAAAAGT
TTTAATCTCCTGACATTTGTGATGTCTTCAAAGGAACCACTGATGCACGTGTGGCCAGGG
TCGCCGACTGCAGTTCTTGGGGCCGGAAGTAACCGATTGCTAACCCGCACCCCGTTTTCT
TTTCTTCTCTACCAGCTCCTGCCCCTCCTAAAGCCGAAGCCAAAGCGAAGGCTTTAAAGG
CCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAAAAGAAGATCCGCACGTCAC
CCACCTTCCGGCGGCCCAAGACACTGCGACTCCGGAGGCAGCCCAAATATCCTCGGAAGA
GCGCCCCCAGGAGAAACAAGTCAGTACTGCCCCCTCTACCCATGAAAAGATTTGGGTATT
CTCCATTGGTAATTTGGAAATCACTCACCCTGTGTGATGGTTTCTCAAACACAAATTGTG
TCCAGTGTGCTTCTCTAATTGGAAGTATGAGGAGATTGTTTCTGCTGTATTTACAAAACT
GGCAGGAATTCTTTTTAAATCAGCTCAGAGGCCGGGTGCGGTGGCTCACATCTGTAATCC
CAGCACTTTGGAGGCTGAGGCTAGCGGATCACTTGAGGTCAGGAGTTCGAGACTAGCCTG
AGTAACATGGAAAAACTCCGTGTCTACTAAAAATAGAAAATTAGCCGGGCGTGGTGGCGC
ATGTCTGTAATCCCGGCTACCCGCGGGAGACAGAGGCAGGAAAATCGCTTGAACCCGGGA
GGTGGAGGTTGTGGTGAGCCGAGATCGCACGATTGCACTCCAGCCTGGTCAACAAGAGCA
AAACTCCATCTCAAAAAAAAAAAAACCCTGAGTCTCAAAATTTGTTAGGTTAATTATTGC
TTCACATGTGGTCACGGTTTGAAAACTATTTTGGGGGTACTGTAAAGTAGAATACAGAGA
TTCCTTGTTCGTAGTTCCTACTGCTATAGGGAACAATCCTTGAGGGTGAGAACGTGGATT
GATTCTTGATGATAATGGGGATTCCGTTATCTGTATTTGGCAGTTATGGGCTGCTGCGAT
GTATAGAAGCTTCTTTGCATTCATTTTCCCGAATTTTCATATTGCTCAAGGAATGGTTGG
GGGGAGATGGGCAATATTTTGGGCACTTGAGTATTTGAGCTACCAGTAATAACTAACTTT
TTAGGGAGCACAGATTTGAGTAGAACCATGGTAGTAGTTACTAGCAATGGGTTTTTGCTG
TTTCTACTCTTTCCTAACAGAAAGAGTGGATTGTGTTCAATAGGAAAGCAGTTCACAGAC
TGTCTTCCTGCCCTTCCCCCCACCAAGTTGGACCTAGGATTGAGTGTGATGAGGTTTAGA
CCTGACCTGGTTTCAAAACAGGAAAGTAGTGTCTGAGTAAACAGCCGGGCTCTGACTTTA
AATGGGGGAAGCTGTTACAGTTGTGCTTAAGCCACTGTAAGTTTAACCTCAGCTGTGCAT
AAGAATTTGCTCCTGGCCCAATTCTGCCTCGGCCTCCTGAGTAGCTGGGACTACAGGCTT
GCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGAGGGAGCTTCACTAAGTTGG
CCAGGATGGTCACGATCTCTTGACCTCGTGATACGCCTGCCTCAGCCTCCCAAAGTGCTG
GGATTACAGCCATGAGCCACCACGCCAGGCCCAAAGATGATTCTTTAATCACTTGAGGTG
TAAGAGCCCTTCAAGAGAAAGAAAATGTACAATGTTCTGCCCCTGGGGTTGGGGCTTCAG
GCTCTTAGATTTCAGGGTGCAGGTGATGACACTGTAAAACGACCAAAGTCTGAACAAAAT
GATTGGTACCTCGTTGTCTGATGCCCTAGGCTCTCCTGGCTCTGGGCTCCAAAGAAGGCC
CAGGCCAGGTGACCCCATTTTGCCTCTCCTAGGCTTGACCACTATGCTATCATCAAGTTT
CCGCTGACTACTGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATT
GTGGATGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTCTATGACATT
GATGTGGCCAAGGTCAACACCCTGATTCGGTGAGCTGGGCCTCAAGGGATGGGGAGCGGG
CTGGACCAGCAGCTGGAGCCAAAAAAACCTGCATTTCATGAAGCTCTTTGATGTTTAGAT
AGTCCTGGTAATGCAGGACTACACGTATAGTCCCAGTTATGCAGGAGGATCCCTTGAGCC
CAGGAGTCACCCATGATTTGCCCCATTGTACTCCAGCCTGAGCAACCAAGCAGGGCCCTT
TAAAAAAAAAAAATCCTCTGGACCTTTCAACAGGGGAAAAAGGTTCCTTGACTTAAACTT
GGAGTAGGTTTAGCAGTGTGTGAGCCTTGAGGCAGGAATTACAGGCTGCCTTAATTACAG
ACCTTTGTATGGACCTGAGGCAACACTTTCTAGGACTTGATTGGGGGTTGGTGCTCATTT
TCTGGGTCCCTACTTCTATTTTCAAAGGCCACTAGAGTGCAGCAGATTACCTTGGTTTAA
GTCTTAACATGGCCTGTGGTGTTTCCCATAAGAGAATTGGCTTCATGGCTTCATGGTGTC
CTCTGGGTTGATGGAAAAATAATCATTGGAAAAGAATGACATGAACAGAGGAACCATTGA
AGTGCTGGAGGACTGGAGGAGGAAGGGGGAGGGTGTGGGGGCAGTGAGGGTGGCAGGGAC
TAAGGCTTCCTTCTCTACCCCAGGCCTGATGGAGAGAAAAAGGCGTATGTTCGACTGGCT
CCTGATTACGACGCTTTGGATGTTGCCAACAAAGTAAGTTTCCTTCCTACAAACCCCCTA
TCATTCACCCCTTGGGTGCAAATGATGCATATGTTAGCGACCAAAGCCTGATTTTTGCTG
ATTAGTCATAATTAACTGACTGCACCCTATCTTAACAAACCTTATCCTCAATGTTCCTCA
TTTTGCTTTCTGAAAATAACATTCCAGCTTAATCTTCTTGTTTCAGCTCCAGTAATGAGG
CTCCCTTTTGTTTTTCAGATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTAAAT
ATATATATATATATCTTTTCAACATATATGTGCCTCTCTGTCAATTTCTGGTTGGGCTGG
GAGGCCACACACAGTACACTGACATAACAGGGCTTGGGCAAGACTCCTGTTCTACTCATC
CTTTTGAAATATTCACCCTGCCACTCTACCATGTGTGATCACTCCAGAGATCTTTCTGAC
TAGAGTTAGTGTCCTAGGAAAACCGGAACTCAGAACTTGCCTCCATGGTTGAGGGTAACA
AGAAGCAGTACAAGAACCCCTTCTTTTATCCCTGGAAGAGGCTGTGTATGAAACCAATGC
CCGGGGTTTGAAGGGCATTAGCATCCATTTCAGGGGAGTGTGGATTGGCTGGCTTTCTGA
TAGCATTTTGTCCTCACACACCCATCTACTACGTCCAACCGGTCTGTCTGCTTCTCTCAC
CCCTTGCCCAATAAAGGACAAGGACTTCAGAGGAGTGCTTTCATTAGTGTTTTCAATAGT
GTGGGCGCAGGCTCGGAAGGTGGAGAGGCTGGCCCCAGAGGACGCCCAGGCTTGGGGCTA
AGTCCCAGTTTCCATGTGAAGCTGTTTCTGGCCTTGTCTGTTTTTGTTGTCCCAGGCTCT
GTGCCTCTCACTCAGTCAAGAACTTGTCTTTGTGTTGCTTCCTGGGGACACGCTCGGGGC
AGAAGTCAGAGCGGAGGAGGCGGGAAAAGTAGATTATGATCATCACGTCCAGCATGAGCA
GGATACCCAGCAGGAAGGTGCCCAGGGTCCTCTGCCTCACATAACGCAAGAAGAAATGGG
TGAGGTAGACCTGAGGGGCCAGGCGGAAGACAAAGTACATGACCAGGTTCACATACTTGT
TAACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved