Macaca_mulatta Locus Mono:170:SNORA42
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:170:SNORA42
Macaca_mulatta
Mono:170:SNORA42
13
SNORA42
1001..1133
2133
TCTGCGTCTCCGCGCCGTCCTCCTTTCCCAACCCGTCGGCGGCCGCGCGCGGGCCGGGG
AGCCGTTGAGGAGGCCCTGGCGGGCGCGCAGCAGGTGCAGGGGCGCAGAGCCCGGACTCG
CCTCGGTACAGACGAGCGGGGCCCCGGCCTTGGCGCCTTCAGTTTCCTTCCAGTTTTTAT
TTTCGCTGTGTCTACAGAGCAGATGACACCAATTTGGAAACCCGCGAGTGTGGGTAGAGC
TAAGATAGTCTTGTAGTAGCTGTGATATTAGCTGCTCGGCCAGCCATGACTTAGAGGTGT
TTATTTAAGGACTCTGAATGACTCGGTGATCTCGGAAAAGCTTGGCTCAGATGAACGGAC
GTACACAGGGGAGCCAGCCCTAAGGTTTTCAGAAAAGGCTGATTGTGCTGTTTGCGAACC
CGAAATAATTGGTGAAAGTGTAGAAGGCAGAACCTCTCAGGAATGTCTGGGGAGGACAAA
GAATGTGTTGGCTGACTTTGTTTAAACATAAAATTGGGCAGACTTTAATTGATTTGTGAA
CATTTTTTGAAAGTTTGTTTGAATTAGCCGCTCTCTCTTCTAACATTACCGTCTTGTGCT
AATTGATTCGCCATTTTAAATAGCTGTTACAGAAAGACCAAAAGGTGCTCTTCAGTAAAA
TATATTCAAGTAAGTTACTTAAGTAACGCTTTAAAAGATACAGAAAAAGCAAAAAAGTGT
TGGCATATTAAAAAGAAATCGAAACTTTCCAAGTTTAGGCCTGAACATTGCCTTAAAAAT
ATGTAACAAGGCCTTAAATGACCCCGTCCGTGTCTGCGTAAGCCTATTTATTATTAAATT
GTAAATATTCTTTATATAAACAATATATAACCATTTCTATAACAAAAATGGTTTTGCTAG
CGTTGTTACTCTCTTGCCTTCTCCGAGGGGTGATTTAGGCAACTTCCGAGGTTGACACTG
CCGAGTAGTCACAATAGATAGAGCTTTAAAGCAAATTCCATGCATGGGTTTGGATTTATG
ACAGGCCCGTCCCCCTGGGCCTGTCATAGTACCCCATGCCAGAGCAAACTGTCCCCGAAC
CATTGCCTGGCCTCTGTGCCTGTAGGTGCTGGCACTGAAGTGGGTTGCACAGTGGAAAAG
AAGAAAGCTCTACCTGCAGAAATTTTTAAAGGTTAAAATAAATAATTTTAAGAAAACTGG
TTCACCAGTGTGTCACATTTGATGAAATCAAAATACAGTGGCTTTTATTGTTACTAGCGT
GATGTTCTTGCTTATTTTTCTTATTGGTGAAGTTAGCCCCAAATTATTCTCATAGCTAAG
CAAATATGAGAGTGCCTGTAAGAACAGTTGGCATTCCGGAATTGCTAAACTTGGTAGGCA
ACGCTGGTTTCAGAATACTGAGTTCTAGCCGGGCGCGGTGGCTCACGCCTGTCATCTCAA
CACTTTGGGAGGCTGAGGCAGGCAGATCACCTGAGGTCGGGAGTTCAAGACCAGCCTGAC
TAACATGGAGAAACCCCGTTTCTACTAAAAATACAAAATTAGCCGAGCCCCGGGTGTGGT
GGCGCATGCCGGTAATCCTACCTACTCGGGAGACTGAGGCAGGAGAATCGCTTGAACCTG
GGAGGCGGAGGTTGAGGTGAGCCGGGATCACACCATTGAACTCCAGCCTGGGCAACAAGA
GCAAAACTCCGTCTCAAAAAAAATTTTTTTTAATTTAAAAATTTTAAAAAAACTGAATTC
TAATTAGGTAACAGCAACTGTAATACAATGTGATAAATTGACTTGAGGATTACAGTTTTT
AAGAAGTATATACCCAGCTAATACCTGAAAATTAACTTGTAAAATCTCAAATGCTCCAGA
CATTTCCATGATGCCTGTTGGTCAGTAAAAATCATTCTAAGACTTAGTGGAAGTAGGAAA
TAGCAAGATGTTTGTATGGCTGTATATAAAGGCTATAATGTAATCTCATCACTTTGGAAG
ACCCAGGTGGGTGGATCACCTGAGGTTAGGAGTTCAAGACCAGCCTGGACAACGTGGTGA
AACTCTGTCTGTACTAAAAAACAGAAAAATTTGTGGGATGTGGTGGCAGGCGCCTGTAAT
CCTGGCTACTCAGGAGGCTGAGGCAGGAGAATCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved