Macaca_mulatta Locus Mono:193:SNORA73
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:193:SNORA73
Macaca_mulatta
Mono:193:SNORA73
8
SNORA73
1001..1200
2200
CTCTCACCAGCAATGTACAAGGGTTCCAGTTGCATCACACCCTTGCCAGCACTTATGAT
TTTTCTGATTTTTGTTTTTTTGTAATAGCCATCCTAATGGGTGTGAAGAAGATTTTGAAA
TTATTGAGTTAGGAGCCATTGCATGATTTTAATGAGGGAATGACACAATCCCTTTTCTTT
TTAAAAGGATCACTCTGGCTGATGGATGGAGAAGAGATTGAAGGGGAGAAGAAAGCAATG
GGGCAGAATAATTTTGAGAAAATTTTGGTGTCCAGGAAAAGAATGATGGTGGTATGACCT
ATGGTAGTAGTTCTGAAGAATAGAGGACACAGATTCAAAATATACTTTAGGGTGAGGCGT
GGTGGCACATGCCTATAATCCCAGTACTTCGGGAGGCCAAGGCAGTCGGATTGCTTGAGG
TCAAGAGTTTGAGACTGGCTTGGCCAACATGTTTGAAATGCTGTCTCTACTAAAAATACA
AAAATTAGCCAGACATGACGGCGTGCACCTGTAATCCCAGCTACGCGGGAGCCTGAGGCA
GGAGAATCGCTTGAACCTGGGAGGTGGGGGTTGCAGTGAGCCGAGATGGCACCACTGCAC
TCCAGCAGCCTGATGGAGACTAGGGAGGCAGACACCAAATTTGGCAATTAATGCCCATAA
AATATTCAGTGAAAACATCAAGAGACAGAGAATTGGATTGGTAACATGGAGACTCAGGAA
ACCAACTCAGAAAGGTTAAGTAAGTAACTTAAGTTCACACAGCATAAAATGCAAGTGGCA
GAGTCAAGAGGCAAACCCAGGACTGTCTGATTACGAGGCCTGGTCTCACCATTTTATGTC
ACTTCCTTCCAGTCAGAGCCCACCAGTCTCCAGGAATTTGGACCGCTGACTGCATTTATC
CACTTTGGGAAATCTCTAGTAATAAAAGAGGGACACGCTCAGTAATAAGTGTGAAGTTTA
GAACACAAACCTTGCAAGAACTTTCAAGAATAAATAAAATTCCAACATGGATAGCCTGGG
AGGTCACTCTCCCCAGGCTCCGTGGAATTGGTGTTGGGGAGCATAGACATTTGGTCCATG
TACAGTACAGCCCCTTTCCACAATGTTGAAGATGAAGCTGGGTCTCGTGCCTGCATATTC
CTGTCGCTTCCCTGAGTCCTGTAGATGATGACTGGTGAGATAAATCATGCAGGAAACATG
TTTAGTGCGAAAAAAAAATAAAACAACAACAAAAAACCCAACATATTTGGAATGTGATAG
ACAACGAGTGAACAGACAATCTCACTTAGAAATTGTCTTTAATAGAGTTAATAAATTCAG
TTGCCTTTCACTGGGGAGCAATGAACAATTTTATCTCTCCCCAAAGACTCTGGAGTCAAA
GGTGGTGTTTAGACTTTTACCCAGGAGTGCTGGTCTCTCATCTGTGTCAGGTACTTGACT
GGCTGGAGGTTAAGAATAGAGATTCCAAAATTTCACAGTACGAGTGGGAACTCACTGACT
AGCTATAAGCTTGGCTAATGCTTCATCCTCTCCAACATTCAGCTTCGTCATCTGTAAAAG
GAATCCCGTAATGTCTATGTCTCAGGGATCCTGTGAGGGTGAGGTTAGGCATTGCACGTG
AAGGGCTTAGCTTAGCAAGTACTAGTTGCTTGCTAATCTTTATTACAATGGCAGTTGAGC
ATGTGCTTTACCTATAGAGCACACTTTACCTCTGAGCACCCTAGAGAAAGGAGAGTTTGG
CAGTTTAGCAAGGGGCGTCAGGGGATGTAGGAGGTTGGCTACACAATGTACACTAAACTC
ACAATTAGGGAGTATAATCATGCTTTGTTCCGAAATGGCAAGTGTTTTGACAATGTGTCT
TTATATCCATTGCTGTTTTTTGTTGTTGTTGTTTGTTTTTTTGTTGTTGTTGTTTTGTTT
TTAAGGTGGACTGTCTCTCTGTTGCCTAGCTTGGAGTGCAGTGGCATGATCTTGGCTCAC
TGCAACCTCCGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCTGCCTCCTGAGTAGCTGGG
ATTACAGGTGCCTGCCACCATGCCCAGCTAATTTTTTATATTTTTAGTAGAGACAGGGTT
TCACCATGTTGGCCAGGTTGGTCTCGAACTCCTGACCTCAAGTGATCCTCCTGCCTTGGC
CTTCCAAAGTGCTGGGATTACAGGTGTGACCCACCACGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved