Macaca_mulatta Locus Mono:222:SNORD23
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:222:SNORD23
Macaca_mulatta
Mono:222:SNORD23
18
SNORD23
1001..1105
2105
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTGAATCTGGTACCAATGTGCCTTC
CTCTAGACTCCCTTACTGCTTCCTGTGGTGTCAGTGACAAAATACTTAAGATAAACCATT
TCAAATGAAAGATCAGCTGGCCAGCTTGAGCTCCACACTCATCTTGACAAGCTAAGATTT
AAATTCAGAAAATCACACAACTAGGGGCTGGCAGTGTTGCCAGATCTTACAACCACTCAC
CTAATGATGTGGTTTTGAAATGTGATGCCAGGAAACTGACCTTTCCTGTGATAAGCTCAT
AACTAATTTCTTTCAAAAACTCACTTGTGGTGAGCATGCTCTCTGCCAGAGCTCGGGACT
GGTGCTGACCTGCAGGATGGAGGGGAGAAGAGAAAACTCATCAACAGAACAAATGTTGCT
GGAACATTACTTATAATGGCAATAACTGGAAACAATCAAAGGATGTCACCATAGGGACTT
AGGTTGAGAAAATTATGACACACCAAAAGGTGTGGACAATTATACAGCACTTGAAATATC
AATTCTGACTCTAGACAGAAACAGAAATGTTTATAATACAGATGATCAAGGAAAAAAAAT
GATGTACCTTATGTTTGTAACTGAAAATATGCACATGTTTGTGTTTAATGATTAAGGAAG
GTCCCTGTCCCCAGCCAGGGGCTGTGGGTAACACCACAGCTGCCCCAGGGCTGGCCAATT
GGGCAGATGTTCAGGGGCTGAGAACATGTGGGAAAAACAGACTAGGGAAGAGTATGAAAA
ACCTTATAAAAATTGTGCTTGCATGGTTATAGTGAATATTTGCCTTAAAAATATAAACAT
GCTTTTAACAAAAATGAAAAAATATTAATGTATCACACTGATGAAGCTTTCTGGAAATAC
ATGTAGCACAGAAAAATGGGCAGACAGGTTTTGTCAAAGTGAGGGGACTTTCTTAGCTTC
TTTGCTCAAAAGTGGTGAGAGCCATTCACTACAAAGAGGAGAGAAGCAAAATGTAGTCCA
AATGGCTACCCAGGAGGGTGCCTGACAGAAAATTTGCACAGTGCAAAACAAACAAACAAA
AATCCCCTTCCACCCCCCAGTTTTGTAGTGTACCAACTTTCTGAATCTTTTCTTTAGAGT
CGATGTTACAATATTAAATAGACTCTTCAGTGAGAAGGGGGATATATGAGCTACTTTTCT
GGCAAATTCGATTAATTGGCTTAGGCCACCTGTGGCACTGGCTTTATCACATGCTAGAGT
AGTAACATTTCCAAAATCTTTAAAGGACAGCAGTTACATGAGACAGGGGTATCTGTTACT
AGGGAGAGCTTTGAAATAATGCTCCCACAACCAGCTGACAGGGGCACCAGCCAAACTGAG
GGCCACACAAAACCTGATCTGAGAAGGAAAGGGAAAGTTAAAATTAGGAAGATGAGCCCA
AGCTCCAGCAATTAATCAGAGTTGACTATGTGGATGCCCGAAACACACAACACACATTTT
TAAATGGACAAATGGTCGAATGAATTGATTAAACAAATAAAAACCAAAAAAGTTACTCAC
CTAACACTACCACACAAAATTCATTTCCTCTGATTTTCGATGCACAAATTGCCACCACAT
AATCTGGTAGCCTTTGATAGTGTCTCATTTCACTGAGAGTCCTTAAGGTCTCTGAAATGC
CCTCCGCCAAAGAGTTCTGGGTCACAATCACATGAACCAAGTCTTGAGATACGCTGGCAA
TTAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved