Macaca_mulatta Locus Mono:76:SNORD28
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:76:SNORD28
Macaca_mulatta
Mono:76:SNORD28
4
SNORD28
1001..1075
2075
AGTATCTAAGTTCATCAAAATGAGATTAATTTATTTTCCAGGTACTATATTCGAAGAAG
GCTATACTGCTGGTGTGTTTATATAAAAAGTGATAGACAAGGAAAGTCTTCATCTCTAAT
GTTGATCCCACTCCCACACCTTTCATTTCTCCTTCAGCATGAACTCTGCATCAAGGCCCC
TCACAAAAGTTGCTGTCGCCTGGTATTTACCTATCCCATTCTGCAGAATCTCCAGAAAAG
AGTTACAGGTTAAAGAAGCCTCTAGCTTCTTCTGCCATCTGTCTGGAGGGTGAAACATGG
GACTTAGGGTACCTTCCCCTTAGGAGGAGCAATGGATCTGGATTCTGAAACAGGTCATTA
CCTGGGGTGGAGAGGTGAAGGGCTGAAGCTTCAAGCTGGCTCTGGTCTAGGCTCTGACAA
TCGAGGTGTCTGGATCACCCAGAGAGATTCAATATGAGAGGAAACAGTCTTGGATTTAGA
CCTGTTTTCTTTCTTGTGTTGTGTCTCTCAGGAACTTAATGCTGCTAGGTTGCAGGAGCT
GTACACCTTTGCTAAAGAGTCACATGAATATGAATGCTAAGTCACACCACACCAAAAAAA
AGTTACAAGAAAAACCTTAAGTGATCATCATCGCAACACTTCTAAGGCATTCTACAGGTG
TCTTTTCATTAATTCAACCCATCTCAGAGGCTTACTATCACATCAATCCAATTTGGAAAT
ATTTGGAAAACTAAGATAATACAATGTGTATTTGTTAACTTTGTAATTTTTCTTCTCAAC
ATTTACTCGAGGCAGGGAAAGATTTTAGAGACACTAGAAGAATAAATGAGCAAGATGTTC
TTTGGACTGTCCCCTTCAAATTAAAACTAAATTAAAATGAAAACACATTAAAATTAAAAC
TCTGTTGACCTTTTGGCAAATTCTTAGTTGTTTTTAGAGTTGACAGCCCTAACAAGGGCC
TCTGTATCAAGAAGTCACAGTGTCAATTAAAGAGGAATCTCTTCAGATGATTTGAACTGA
TAAGCTGAGGCTCTATGAGGAATGACAGTTAAGAGCATATTAAAGTTGTTATGAAAAAAA
GAGAAAACTCTCTGAGTCTTTGTTTGATGTCGGATGCAGAACTGAAGACCTTCTGAGAAA
ACGAAGGAGCGTGGTTCACACCTTGATGAAATGCAAGCCCAGAAGCACACCCAGTGTGCT
CCCCTGATGGCCAGGAGCAATTCTCAACTCCAACACTCTTGAAATTTGGGGCCAGATAAT
TCTTAGACTGGAGGAGGGGGCGCGGGCTGTCTTGTGCATAGTAGGATGTGGGATGTTTGG
CACCTTACTACATGCCCACTATGTGTCAGTAGTACTCTACCCAGCTGTGAAAAGCAAAAA
TGTCAATGTCCCCTGGGGTAGGGAGAGCAACAACCCCAGCTGAGACCCACTGGCCCAAAG
CTAGGGCCAAAGCCTTTTATAAAAACTGGATTTAAAATCTGCTCAAGTACTCTGACAGAT
CTTGGACTGCAACCTCCAGATTTCTGAGCCAAAGAATGAAAGAAAATATTTTGGTCTGAA
ATTTTTAAGGTTAAGTCTTACTGCCTGGGTACCTCAATAATTTTGAAATCCCAATATGGC
CCCAGGATAATTTTCAGATTGTCAATAGCGCTGAATTCTCATGAGTCCATCAGGCTGTTA
GCTGCCATAGGTACCCGCAAGAACCACAAAAATAGTCTCTAACATGAATAGAGCTTCACA
TTCTACCCAGAATTTTTACATTTGTTATCTTATTTAAGTCTGCATGAGTTATTTATTTAG
AATTTCCCAGTTTGGACAAAGTCTAGCTTATCTCTGAGGAATCTTGGTCAGCCACAATAA
TTTTAGTTTTCGTATAGTAGATACTTTCTGATGATAATCAGGAAAAGAGCTCATCAGTGT
TTTATGGCCATTCCAATAGGTGGTACTAAGATTATGTCGTCAACATGGAAGTGGATGAAT
ATCTTCCTAATTGCTATGAAAGACAGAGAAACATCCAAATTATCTAATTGTCGCACGGTT
ACTCAAATACACGTTTAATAGAAGAATGGCATTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved