Macaca_mulatta Locus Mono:146:SNORA48
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:146:SNORA48
Macaca_mulatta
Mono:146:SNORA48
20
SNORA48
1001..1121
2121
TGTAAACGGTGGGGGCAGAGGAGCAGTACAGGCAATGGCTTCAAGGTGGGGAGCAGGTC
TGGCGTGCTCCAGCAACAACTCGGTCAGCACAGAGGGGGCAAAAGGCAAGGAGCAGATGA
ATGCAGAGTAATGGGCTGGGCTGTGTGAAGCCTGTGCTGGCTGACGCCTCTGGAGACCCA
GTGAGAATCCGATCCTTGCTGCTTCCTCTCCTCGGCCTGTGGCTACATCACTCCTGTCTG
AAATCAAGGATCCTTGTGATTGCACTGAGGGACTTTCTGGACAACCCAGGATAACCTCCC
CATCTCACAATCCTTACATCATAGATTCCAGGATCAGGATTGGCATTTAGCCAACCACAG
CCACTGAGGACTGCGGGGATAAAACTGGCAAGATCCAATCCATATGTTGGAAAATGGATT
CCTGGTGCTCAGAAATGACCAATTTTTAAGAAGCAATGAGTTTCTGAAAAAAATACAAAA
AATATATATATATAAAATATAAAAAAAATATATTTATCTAAAATATATATATATATATAT
ATTTTTTTTTTTTTTTGAGATGGAGTTTTGCTCTTGTCACCCAGGCTGGAGTGCAGTGGT
GCGATCTTGGCTTACTGCAACCTGCACCTCCTGGGTTCAAGTGATTCTCCTGCCTAACCT
CCTGAGTAGCTGGAGGAGCTTTAAAAAAATATTTTGGGGGTATTTTTAGTAAAGACAGGG
TTTCACAATATTGGCCGGGCTGCACTCGAACTTCTGACCTCAGATGACCCACCTGCCTCA
CCTCCCAAAGTGGTGGGATTACAGGTGTGAGCCACCATGCCTGGCCTGAAAAAATTTAAA
TTTAATACCACTGCAGTGTACAAAAGACTCATTTCAATGTATAAAAGACAAAGTCCTAAA
ACCGCTCCCCGCATGCTGAAATGGTGCCACACAGATGGGGAACCTTGCCAAGACTTCAAA
GAGACCTGTGGCCCTAAAACACTTAAGAGGTTGTCACTCCACCCTGACCTGGGCAGAGTG
GCATCTGGTTGGTGGTGTCCATCTTGCATCAGTCAGGGACAAAGCAACCCCTTGTTCATC
TCAGCTTGGTTTCTGGCCTGTGCCCATGCCTTGGACAAACAGAAAAAGCTTAGGAGCCGT
TGCTTTTCAAGAAGATTTCACACTTTCAGGCCCCCGAAGGAAGAGTTCCAAGGGTTCCTG
AGTTTGATGAAGGCAGAGCTTACAGAGTGCATACACTTTAAGCACACAGATTGATGATTT
ATTTCCAAGGGTCAGCAGTCAAGAAACTCGACAGAGACAGCTCTCTCTGGCTGGCGATTT
CTGGGATGTGGGGAGGAGTCTGTGTGTGCCCCTCCTGCTTCTAGAAATTCAATCTCTAAC
TCCCATCCCAGCTACAAGTGAAACTTTCTCCAGGGCAAATGAGGTCTATGGTGTCGGCAT
CCGCACTGGCCCCAGTGCTCAGCCTTGCAGACCTTCCCTGTGAGGGCTGGCAGCTGCCAG
TGGCTGAGGCCTGAGTTGGCTGTTGGCTCAGACCCAGGTTCCTGAGGGGGGCGGGCTCCC
TTTGTGATGTCAGCATCCTGCCCCCACTCACAGCCCCTTCACCAACCACCTCACCTCCTT
GTCCAGAAAGACAGGCAAAGTGGACCATGGGTTCCCGCTGTGCCAAGCTCAACACAGGCC
ACAGCCCAGGCCACAGCACAGGCCACAGTATGGGCCACAGCATGGGCCATGGCCGGGGCC
ACGAATCCTCCATGAAGAAGCTCGTGGCCTGCGTCAGTCAAGATAACTTCTCCTTGTCAT
CAGAAGGTGAGGAAGAGGAGGAAGAGGAGGAGGAAGGGGAAGAGGAGGAGGAAGAAGAGC
TGCCAGTGCAGGGCAAGCTGCTGCTGATGGAGCCTGAGCGGCAGGAGGAGGGCCAGGAGG
ACAACGCTGAGGCCCAGAAGAGCCCCGAGTCCAAGCAGACACACTCCTGACCCACGACGA
AGGCCCAGGAAGGGACACCCACTGCTGCTCCGGCGACAGCATTCAGAGAAGAGTCAATAA
AAAGTCTCTGAGGAATCCTCCCTGTCTCTGGTTTCCCCTCACCCTATCCCTTCTGGTCCC
ACGTGTGCACGTGTGTGAATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved