Macaca_mulatta Locus Mono:94:SNORA26
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:94:SNORA26
Macaca_mulatta
Mono:94:SNORA26
1
SNORA26
1001..1112
2112
TTCCGAGAACGGACGGCCTCCTGGTGGCCATCTTGGATTTGGGCAGTAGCCACGCCTTC
TTTACCTTCGTTATGCCCTCAGCGTTAAGGCGCCTGCGTGTTCTGGTTGGGCTCTTTCTA
ATTGGCGGAAATTGAATCACCAGACGCTTATTGAAGATCCAGTTGTAAATAGGGGCACCT
TGTGTTTGGGGGTGTTGGAACCTTTATATTCAAATCAAGACTGGGCACGGTGGCTCACAC
CGGTAATCTCAGAATTTTGGGAGGCCGAGGCGGGCGGATCACCTGAAGTCAGAAGTTCGA
GATCAGCCTGGCTGCCTTGGCGAAACCCCGTCCCTACTAAAACTACGAAATAAATTAGCC
GAGAGTGATGGCGCGCGCCTGTAATCCCAGCTACCCGGGTGGCTGACGCACGAGAATCGC
TTGAACCCGGAGGTTGGAGTGAGCCGAGATCGTGCCACTGGACGGCGACAGAGCGAGACT
CTATCTCAAAAAGAAAAAAAAAAAAAAAAGAACAAATCTAATGTGAGATTTTTATATAAC
TTTTTCTTCTTTCCTCTTTTTTGTTTTTTAGAGTCACAATATTACTCTATCGCCCAGGCT
GGAGTGCAGTGGCAAGATCATAGCTCATTGTAACCTGAACTCCTGGGCTCAAGCGATGCT
GCGGATTCAGTCTCCTAAAGCACTGGGATGACAGGCGTGAGCCACTGTGCTGGTCGCATT
TCTCATTATTTATAGAGCCAAAATAGTAGAGGTCAACATGCAGCAAGAATGACTGAGGAT
ACACAGCCAATTTTGAAGTTTGGGAACTCAAAAAACTGCAGGAATGGGGGACAACCTGAA
GGTGGAGAAAAATGACATTAAGGGTCTTTTCCAGCTTTTGAAGCTATTTGCCTGTATATA
GACTTAAAAGAAGAGGAGGGAGCACTTTAAATGAGGGGCTAGGAGGCATAGGCTGCAGAG
TCAGTTCATTTCAAAGTTGATATCTCTACAATTCAACGACAAAAAGACAAACAACCAAAT
TAAAAAATAACACAGAAGAGTAAGGTAAGTCTCCATTAAACACAGGAAAGAGACTGGAAA
ACTCCTCTTTGGATCCTGTCTATAGTCGCAGGTGAAATAAAAGAAATAAAAGGAGAGAAA
AATGGGCAAAAGACTTGAATAGACCTTTCCCCAAAGAAGATATACAAATGGCCAAGAAGC
ACATGAAAAGATGCTCACCATCATTAGTCATTAAGGAAATGCAAATCAAGTTGATAAAAT
GCCACTTCACACCCACTAGGGTGGCTAAAATTAAAACAAACAAAAAGCAGAAAATGAGCG
TTGGTAAGGGTGTGGAGAAATTGGAACCCTCAGATATTGCTGGTGGGAATGTAACATGCT
ACAGCTGCTGTGGAAAACAGTGGCAGTTCCTCAATAAACTAAACTTAAAATTAGCATATG
ATTCAGCAATTTTACTCCTGGGTATATACCCGATACAATTGTAAACAGACATTCAAACAA
AAACTCATACACGAATGTTTATTTTTAGCAGCACTATTCACAATTGCCAAAAGTAGAAGC
AACTCAAATGTCCATCAACCCATGAATGGGTGAACAAAATGTGGTATATTTACACAGTGG
AATAGTATTAAGCAATAAAAAGGAATGAATGTGTGCTACAACATAGATGAACCTTGAAAC
CATTAAGCTAAGTGAAATAAACCAGATACAAAGGGCACATATTATGTAATCCTATTTATT
CCAAATAACCAGAATAGACAAATCTATAGAGACAAAAAGCAGTTTAGTGGATAAGTGATT
GCCAGGAGTCTGGAGATTAAGGGAGAGGATGGAAAGTAACTAATGGGTTCAGGGTTTCCT
TTTGGGCAATGAAAATGTTCTAGAACTAGGTAGTGGTGATGGTTGCACAATATTGTCTAC
ATATTAATGTTATTAATAGTAAATTTTATGTTATGTGTATTTTACTATTTTTATTTATTT
TTTGTTTATTTTATTTTTTTTTTTTTTGGAGATGGAGTCTCACTCTGTCTCCTAGGCCAG
AGTGCAATGGCATGATCTTGGCTCACTGCAATCTCTGCCTCGCAGGTTCAAATGATTCTC
CTGCCTCAGCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved