Macaca_mulatta Locus Mono:54:SNORD37
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:54:SNORD37
Macaca_mulatta
Mono:54:SNORD37
7
SNORD37
1001..1065
2065
ACACACACACACACACACACACATACTACATATACAGGTGGGTGAGGATGTAGCATGAA
AATATACCACAATAAACTAGGTAGGTTTTAAAAAATTATTTCTTCTGTCTTTTCCTTCAC
TATTCAAGCAGAAAGAAGAGCTTACCATGTACAGTGAACACAAGAAGAGATGACACAAAA
GAATAAAGGTCCAATTTACTGAATTGTAAAATTTTAGATAGATTTTGAAAATATCTAGTA
GAGGTAATGATCTTGAAAGTCGGAACTTTTATTTTCAATAAATAAGCATTTAAGAAAAAG
AAGTTTGTATTTTCTTATTCCAAACATTCAGTTTTAAATGTTAAAAATACTGAAAGTTCA
AGGCATGAGTTTATAACTAACACCACTATTTTTTTAAATTATACTCCAAGTTCTAGGGTA
CATGTGCACAACGTGTAAGTTTGTTACATATGTATATATGTGCCATGTTGGTATACTGCA
CCCATCAACTTGCCATTTACATCAGGTATATCTCCCAATACCATCCCTCCCCCATCTCCC
CACCCCACGACAGGCCCCGGTGTGTGATGTTCCCCACCCCGCGTCCAAGTGTTCTCATTA
TACAATTCCCAGTTATGAGTGAGAACATGCGGTGTTTGGTTTTCTGTCCTTGTCATAGTT
TGCTCAGAATGATGGTTTCCCTACAAAGGACATGAACTCATCCTTTTTTATGGCCACACC
TGTAATCCCAGCACTTTAGGAAGCCAAGGGAAGTGGATCACTTGAGCACAGGAGATCGAG
ATCAGCCTAGGTAACATGGTGAGACCCCATCTCTATCAAAAATTACAAAAATTAGCCAGG
TGCAGTGGTGCATGCTTGTAGTCCCAGCTACTTAGGAAGCTGAGGTGGGAGGATCGCTTA
ACGCTGGGAGGTCGAGGCTACAGTGAGCTGAGATTGCACTACAGCACTCCAGCCTGGGCA
ACAGAGTGAGACCCTGTCTATTTAAAAAAAAAAAAAAAAAAAAAAAGAGTAAGTAACATT
TCTTCAATTTGACCTGATATGTATTGAAGAAAACCAGCATCTGAGGCCCATGGAGAAAGA
AAAAGAATAAACTTGGACAAAGAAACAGACATGCATAAAGGGAAGAAAATGGAAAGAGAC
ACAGGAGTAAATGGCCATCTACAAGAAGAGAGGCTTGGACAGATTCTTTCTGCTCAGCCC
TCAGAGGGAACCAAACCTACTGACACTTTGATTTCAGACTTCGAGCCCCTGGTGTCATGC
AGAAATGGGATTTAGTTACAAAGTTTACAGTTTTTTCAGAGGAAAGACAGCCTGGAAAGT
CAGACCCCAGTTCTTTTTGTTCTGGAATCCTCTCAAATTTACTCAGAATTTTCACTGCTC
TGTCTGTCACCTAAGGACATCAGTGGTGAATGTAGCAGGCTAGAGACTGACTTCCAAGAC
TAGGTAACAAGCGCTATACCGCTATACCTCAGCTAAAGGCAGACTGGAGCACAAATGGCG
TACAAATGCAATATCCCCCAGATGCCTGGAGCACACACATTCTGCTTCTGTTTCCTGTGG
GGCAGAAAGGTGAATCAACTGAGCACTAGTTTCCAAAATACTGTTTCTCATAATGAAAGT
GACTGAGTGATCTTGGATTGACAAGCACTCACCATCAGCAAAAATCTGAGTTTGAGAATG
TATGCAGGTATAAAGAAACAAAGGAAGCCATATTTTTTACATAGCTAAGTTTATAACAGT
ATAAATACTGCATGATTTTCATTTCAGCAAATGTGCTTGGCACTTTAATCAAGAGCTGGG
AATACAGGGATGCATGTCTCTCACGTATTGACTCAAGACTGGTGCCAAAGCAGTGTAAGG
CACATTCCATGCATCATCAACATCCCACACATCAGATCAACTTGTAAATTTCATTATCAA
TCCTCAGCAAATTAACAAACTGAGGATTACCAAGATTTTGTTAATCTTGGCAATTTGTCA
CATCATTGCTGATTCATTGGCAGGGATCAAACCCAGGTCCACTCAACTCTGCTGCCTGCC
TTTTATTCACAAGGCCATAGGAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved