Macaca_mulatta Locus Mono:43:SNORA48
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:43:SNORA48
Macaca_mulatta
Mono:43:SNORA48
7
SNORA48
1001..1133
2133
CCTCAAAGTCCTGGGCTCAAGCAATCCCCTTGCCTCAGTCTCTTGAGTAGCTGAGACTA
CCAGCTTGTGCCATGACACCCAGCTAATTTTTTTAATTTTTTATAGAGACAGAGTCTTGC
TATGTTGCCCAAGCTGGTCTTGAACTCCTGGCCTCAAGTGATCCTCCATAAGCCACCACA
CTCGGCTTAAACTGTCTTAAGACTTAGAGAGGAAAAAGTGGTATTACAGTAAGCTTCTTG
GGCATGATTTACTCACAGACTATTTACTCCAAAATCTAAAAGACACTTTTTAAAAGCGGG
ATGAGGTGACTCTTCTAATTTAGTCAGCATGAGCAAGAACAAACAAAACCTATAAACTCA
ACTATTGAAAGTTACTTCGAACTTTATACTGAAAAAGTACTATACAAAAATTTCCATTGG
TTATTCCTCATGGTCACTTTTACAAGATGGTTTGTTCCCAACCAGCTAAATGACTTCCCT
CGTTACCCACTGTATGCACTATTTCCCTTCCGACAGTGACATCCCCTTGCTCTCTGTCAA
GTAGGATTAAAACTTTTCAGACTCAAGTCTTTTCCTTTTTCTCATGGCTCTCCAGATATT
ATTAGCTGTTTCTTCAAGAGGCTTTAGAGGCAGAGATTCTTAAGCTTCACATCCTGGCTC
CACCATATACCAGCAGTGTGAACTTCAGAAGTAACCTTCCTTTCTCTGCATCATTTGCTG
ATCTGCAAAACTGTATTCATAGCCACACTTCAGTGGCTCGCTGTGAGAATAAAATGCATT
TAACATACCACTTGTTATGTAAACTCGAAATAAATTGCTATCGCTATTATTATGTTTTCT
CACTACTACTTCCCTAGAACAGGCCTTTACTGCTGCTAGATTACGTCCACTAGATTATGT
CTGCATTTCCTCAACCAGCCCACTCCATTCATGTCTTTTAGTAATCCAAAGTATTGTGCA
GATCACCATCAGATATACCTTGAATACATACAAATACCTCCTGTTACTCTCTAGCTTAAG
AACCTTTAATGTGGTGATGACCATCTCATGTCATCCAGGGACAAAGCAACCCTTGTTTAT
CCCAGCTTGGCTCTTGGTCTGTGCCCATGGCTGGTTCGTGCCTTGGATACATGGAAAATA
AGTAAATGATTAAAAAATAAAAATTAAAAATCTTCTATGGATCCCTGCTTACTAGCACAT
CAAATCTAATTTACTCTGTCTAACTTTCATTATCCTCTCTTAACAGCAGTTTCCAAACTT
TCAGTGTACATCAGAATCATCTGGCATGCTTGTTAAAATACAGATTGCTGTCCAGAGTTC
CCAGTTCAGTAGGTATGGGAGCAGGGCCTTAAAATCTGCATTTATAATAAATTTCCAGGA
GACGCAGTTGCTGCTGCTGCTAGTCAAGAAACCACATTTTGAAAAGCACTCTTCTATCGT
GACCAGCCTGACCAACATGAAGAAACCCCATTCCTACTAAAAATACAAAATCAGCCGGGC
GTAGTGGCGCATGCCTGTAATCCCAGCTACTTGGGAGGCCAAGGCAGGAGAATCGCTTGA
ACCTGGGAGGCGGAGGTTGTGGTGAGCTGAGATTGTGCCATTGCACTCCAGCCTGGGCAA
CAAGAGCGAAACTTCGTCTCACACACACAAAAAAAAGACAGAAAGAAAAGTACTCTTCTA
AAATAGACCCCATTCTGCCTCTGTAGGCTTATTTCTCCTTCCTCCCCACCTAGCACACAC
TGCTTTGACCGGATCAATCTTTTCATAGACTGTGGCCAATTCTCCCACCCTGCACTGGCC
TAGCACACTTTCTTGCTTTTCCAAATCAAACCCAGCCTTTAAGCCTGTAATTCTTAACAC
TGCCTGCACATTACAAACATCTGGGAAAGCTTTTAAAAACTGCAGGTGCACCTCACCCAA
GATTCTGATTCATCTGATTTTTGATTAAGTTTTCCCAAGTGATTCTAATGAGCAGTCAGA
GTTGAGATCCACTACTTAAACTTTAATCTCCTTCCTCTCAGAATTGTGAATACTCACTGG
ATTTTCTCCCCTGTAAATTACTGTAATGTTGACAGATTAGATCAAGTTTTTGCTTCATTA
CATATCTGTGTTATTCTCTACCTTTCATTGTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved