Macaca_mulatta Locus Mono:295:SNORA77
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:295:SNORA77
Macaca_mulatta
Mono:295:SNORA77
6
SNORA77
1001..1125
2125
AGACAGTAATTAGGCAAAAGAAAAAAAAGGCATCTAAATTGAAAAGAAATAAGTTAAAG
TGTGCCTGTTTGCAGACACATGATATTATATGTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
TACCCAAGGAAATCTTGACCAAAAACCAAAACAAACAAAAAAACCTAGAGGTATCAAACT
ACCTGATTTCAAAATCTACTCCAAAGCTATAGTAATCAAAACAGCATGGAACTGGCATGA
AACAAACACATAGACCAATGAAATGAAATAAAGAGCCCTCAAATAAATCTACACATTTAC
AGTCAATTGATTTTTGGCAGAGTTTCCAAGAACACACATGGGAAAAGGACAGTCTCTTCA
ATAAATGGTGTTGGGAAAACTGGCTCTCCACATGCAGAAGACTAATATTAGATCTTTATC
TCACATTATATTAAAAAATTAACTCAAAATGGATTAAAGACTTAAATGTAAGACCTAAAA
CTGTAAAATTATTTAAAAAACAGGGAAAAGCTCCATGACATTGGTCTGGGCAAAGATTTT
TGGAATATGACCCCCAAAATCACAGGCAACAAGAGCAATAATAGGCTCATGTAATTACAT
CAAAGTAAAAAGCTTCTGCACAGCAAAGAAAACAACCTATAGAATGGGAAAAATATTTTC
AAGCCATACATCTGATAAAGACTTAATATATAAAATATATAGGGAAGTAAAATGGCTCGA
TAGTAAGAAAACAAATAACCCAAATTAAAAATAGACAAATTGCAGACTCACTTGGAACCT
GACTGCAACTCAAGATGGGTGCTTTTTCCTTCTGCCAGAATAACATTCTGGGGTGCTGTG
GCCACCTGACCTGTCAAGACTTATGTAGCTGCCCAGGAACACAGGGTGCTAGAGAACAAA
GGACAAAGGACCTGAATAACACTTCTAAAAAGAAGATACACGAATGGCAAGCACGTATGT
GAAAAAAATGCCGACCATCACTAATCAGAGAAATTCAGATTAAAACCACAATGAGATGTC
ACCTCACACCTGTTATAATGGCTATTACGAAAAGGACAAAAGATAACAAGTGTTGGCAAG
GATGTTAAGAAAAAGGAACTGTCGGTGGTGACGTAAACTAGTCCAGCCATTATGGAAAAC
GTATGGGGTTCCTAAAAAAAAAAAAAAAAAAAAAATAGAAGTACCAAATGATCCAGCAAT
CCAACAATTGGGCATACGTCCAAAGAAAATAAAATTGGTATATCAAAGAGATATCTGCCC
CCATGTTCATTGCAGCATTATTCACAATAACCAAGATATGGAATCAAGCTAAGTGTCAGT
CAGCAGTTAAATGGATAACAGAAATGTGGTATGTATGTACATAATGGAATATTATTCAGC
CTTTAAAGAGAAGGAAATCTTGTCTTTTACAACAACATGGAGGAATCTGGAGGATATAAT
GTTAAATAAATTAAACCAGGCAGAGAAAGACAAATACTGTATGATTTCACATATATGTGG
AATCTAAAAACACTGAACTCATGGAAGCAGAGAGTAGAATGTTAGTTTCCAGGGACTGTG
AGGGGAAAGATGGGGGAGATGTTGGTCTAAGTATACAAAATGTCGGGAGAAAAAGTTCAA
GAGATCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved