Macaca_mulatta Locus Mono:80:SNORA48
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:80:SNORA48
Macaca_mulatta
Mono:80:SNORA48
1
SNORA48
1001..1135
2135
TTTTCTTATTCTTTTTTTTTTTTTTTTTTGACGGAGTCTTGCTCTGTCACCCAGCCTGG
AGTGCAGTAGCGCAATCTGGGTTCACTGCAAGCTCCGCCTACCGGGTTCATGCCATTCTC
TTGCCTTAGCCTCCGGAGTAGCCCAGGACTACAGGCGCTCGCCACCACGCCTGGCTAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTAAG
TGAAATTAATGATAGCCATGATAAAATTAGGGGCAGCAAGGAAGAATTAGGAATACTTTG
TTAATAAAAGGCACTTGAGGCTAGGCATGGTGGCTCACGCCTATAATCCCAGCACTTTGA
GAGGCGGAGGCAGGCGGATCACCTGAGGTCAGAAGTTCAAGACCAGCCTGGCCAACATGG
TGAAACCCTGTCTCCACTAAAAAATACCAAAAAAAAAATTAGCCAGGCGTGGTGGCGGGT
GCCTGTAATTCCAGCTACTCAGAGGGCTGAGGCAGGGAGAATTGCTTGAACCTGGGAGGC
GGAGGTTACAGTGAGCTGAGTTCATGCCAGCCTGGGTGACAGAGTGAGACTTCATCTCAA
AAAAAAAAAAAAAAAGGCATTACCTGTGAAGTGGTAGCGTATAGTGTTATTTGAAATTAG
ACTTGGACTAGTTGTGAATGTATATGGCAAACTCTAGGGCAACTTCATATGCTAACAGAT
AGAATGGAATCACAGAAAATGCTCAATTAAAACCACAAAAGGCGTGAAAAAGAGGAGAAG
AAAAAAATAGAACAAAGAATGAGGGCAACGAATAAAAAATGGTAACAAATATGGCAGATA
ATCCAGCTATATAAATCATCACCTTAAATGTTAATGATCTGTGTCTTTGACCTCAGTAGA
GTGGCACCTGGTTGGTGGTGCCCGTCTTATATCAGCCAGGGACAAAGCAACCCCTCGTTC
ATCCCAGGTTGGCTTTTAATCTGTACCCATACCTGGTTCATGCCTTGGACATATGGAAAA
AAAATGTCAATGGTCTAAATACACCAGTTAAAAAATAGAGTGGATCAAAAAATGAGACCC
AACTATATGTTGTCTATAAGAAAATCATTTGAAATGTAAAGACACATAGATTAAAAATGA
AGGGCTAGAGAAAGATACACCATGCTAACCTTAATCAAAAGAAGGCTGGAGTAGCTGTAT
TAATTTCAGGCAGAGTAGACTTCAAAAGCAATGAAAATTATCAGGGATAATTACATAATG
GAGCAGTACATAATGATACAGGGGTTAATTCTCTTAAGAAGACAACAATCCTCAACGTGT
ATCCACCTGACAATAGAGCATGAAAATATGTGAAGTAAAGCCTGATAGAACTGCAAGGAA
AAAATAGATGAACACTTTATTATAGTTGTTTTCAACCCCTTCTGTCAAAAATGGTCAGAT
CCTGCAGGCCAAAATCAGTAAGGACATCATTGAACTCAGTAGCACCATCAGTTGACTGGA
CATAATTGACACCTATGATTACTTTATCTAATGATAGCAGAGGACACATTTTCCTCAAGT
TTATATGGAACATTCACCAAAGTAGACCACATTCTGGGCCATATATCACACCTTAACGAA
TTTAAAATAATAGAAATCATACAATGTATGTTCTCAGGCCACAATGGAATTAAACTGGAA
ATCAGTAACAGAGATAGCTGGAAAATTGCAAAATACTTGGAGATTAAACAGCACACTTCT
AATTAACACATGGGTCAAAGAAGAAAAGACAAAATTAAACTACAACTTATCAAAATTTGT
GGGATGCGACAAAAGCAGTGACTAGAGGGAAATTGAAAGCATTGAATCCATATACAGTTG
GCTCTCTGTAATACCAGGTTTCACTCCTGGATTGAACCAGCCATGGATTGAAAATATTTG
AAATATGTATATATAACAAAAATAATACAAGTGAAAAACTACAGTGTAACAACTCTGCAG
CATTTACATTGTATTAGATATAAGTAATCTAGACGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved