Macaca_mulatta Locus Mono:234:SNORD43
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:234:SNORD43
Macaca_mulatta
Mono:234:SNORD43
X
SNORD43
1001..1063
2063
TGCTCAAGGTACTAGTTTTCTTGTTTCCATCCCTCTTTAATATAGTGTACACACATAAT
CCTGGACACACTTTTCCTGTGTCTGATTAAATTCAGGTATCCTTTTCATCAGGTTTAACT
TCCAGATTATCTAAATGGGCTTTCCATAAGGAGAAGCAACACACTGCAGGAGGTTTTCTT
TTCTTTGCCTTTTTGATAACTGGCCTAGGAAACAAAGATTCTGTGTTTTACCAAGATAAT
TTCCTGTGCTTCATGTCTTTATTAGGTTTTTGATTATGTTGGGAAACTAACCTTCAGAAG
AGTTCAGGTTTCTACATCCAAATAGCATTCTGTATTGCTTTTAAAGTCTTTTGGTTATCA
CTCTGGTTAAGAGAATAAATATTATTTTACAGTCATCTGTGATTCTGTTTAATCAAGGAC
TTTGAACCTTTTGACATCTTTGGCAGGTATCCACAGGATCAAAATCCTAAGTCTTTTTGA
CCTAAAGCTAACTTTGGGATTTTCTAATTGGGCCTTGAAGAGCATAAAAGAATGTGTTTG
TCATCTTGTGGAAATATTAAATGATTAGGCTTACGTGGTAAATTGTATGGGAAACATTGT
TAATTGATAAGTGATTCTGGATCCTTTCTCAGTTACACTTATGGGTATATTATTAAAATA
TATTTCAAAACTATAGGTTCCTACAAATCTAATATGTTATCAGTCATAAACCTGGATTAT
TAGTATGAGTATTCCAAAAAATTACATGAAATTTGTAAAAGTCTGATGGTCCTGATGTGA
AGATGTCAATTATAATTCTGGTTGTTATCTTAAAATGCTGCATATAGTAGAGGTGGCTCA
ATTGCCTTGTCAATTGTAAACTCTCATCAGATTTTTGACCATGACTGTTCTGGGTTTTTG
TCATCCATGGTTAATGTTTTAATTCTTCTCTGGAAGCAGTTGCAATCAGCTGTAGTCCAA
AATTGTTTTTCATGGAATTGCTAATCAAGATTGAGTAAAATAATGGATGATGAAATTATT
GATGGGTGGATAAAAACTGTGTGCTGATTGTCATGTTCTGATTTGTCTCTGTCGCACTCG
CGTGACCGATGTGTGTCCATGTAGCTCCTGTCTGGGAGCTGGAGGAAGCCTATAACACTT
TTAACTGCTACCCAGCATTTGTCCCAGGAGTCCCTTTAGTGGTCAAAGTATTGCTAATTG
GCACATAAGGCTATCTGTTAAGCAATTTTTAATGCCACTACTTAGTGTGTTTTTGTCTGG
TGTTAGAGAAAAAAGTGGATGGCTAGTTTTCTTACAAGTTGAAAGGATTTAAAATAAGGT
TTAGTGTAAATTTTGTTGAGTACAAAAGCATTCTTGATGTGTGTGAGCCTAGAAAAGATA
ATTACCCCTTTACTCGGCTTTCTGGGTGTCTGGTCAAGATTGAGTACTGCTGAGAATATT
TAGAACTTAGGCAACTGGGAACTAGAGAGTAAGGGTTGCTTTGGTTTGGATGCTAATGGT
GATATTTTTCCCCTGGGAGAAAAAAAGATTGAGTAAAACAAAATAGTTTACATAAAATTA
AGTAATTGACAAGGATATTGTTTTTATGACTTATTGAAAACATTGTTTTTTCCTTAAATG
TTTTGTTCTACAGATTTAATAAAACTTTCTTTCATAAGCTATCTGTAGTATGCAATAATT
TGGTAAAGTATCTTTTTATGAAAGGTGGGAGCATTTGCTTTTTCTCCCTAATTGATTTCT
CAAAAATTCAGAAACTAGTCACAAGTATTCTTATTTTTATTTATATAAGTTCAATAAAAA
TTTGCTGTCTCTTTATAAGCAGGATATAATTGGAAACATTGGCTATGTTATCAAGGTTTT
GACTGATATGTCATATTTATGAATATGCATAAAATACCTGGCTTTAGGAGTTCCCAGCCT
TAGTGAATGAGTAGACATTGTCACTTCCTGGAGGGCCCAGGAACCTTAAGGTTTTAAGTA
ACATTTAAAGCCTGCCGTGCATTGGTTTTCTAGCCTCAACAGGTTTTTAAATCTGGGATT
CCTATATGATCAATGTGGAGATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved