Macaca_mulatta Locus Mono:90:SNORA42
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:90:SNORA42
Macaca_mulatta
Mono:90:SNORA42
1
SNORA42
1001..1134
2134
CAATACAGTCTTCAAACATGTACTTTGTTTTAAATGTTTTTTTAAAAAACATGAGGGCC
ATGATAGACTAACAGGGCCAGATTTATTCTCCCACCTGAAATAACTATGAATTAGGACAA
AACATAGGAAACAACAGGATTCAAGAAATTGGACATCAGGTAACAAAAGACCATGATTCT
TGAGAGACGGGAAACAAATTAGGTTTTTCCTACAGTTGTCACAGCTTGCTGTCTAGAGGG
ATTTTTTAGGTTGTACAGGGAGAGGAAACCCAGGCAGAGACTATTGATCTCCTTGTCTTG
AAGAGGGAGGCCTTGGATTTCAAGGAGGCCAAGGAGACTAGAGTTTGCAGGACAGAGTAA
CAGAGATGAGAGGGCTGCAGAGAAAGAAAACCCTAGAAATCCACAGCAAATCCCCTCAAG
CATTCAACCGAGTCCTGTTGAGTGCAGGTGTGTGAGGAGAAAATCCTCTGAACGGATAAG
AGAGAACAGTACCTGGAACTCATACAGGAATGTAAATAGTGCCTGTTATGACCAGCCAGG
CTGGAAAACCTCAGTTTATGGAGCACTGGCTAGTGTAATCAGGGAAGTATTGCCTCAGTA
GTGGGACAAAAAGCCCCCTAGTTGAAACATTGCTCAGGTTGTGCCAAAGAAAGCTTAGAA
GCAAGACCTGAAAGTGTCAAACTCTTCTAATAACTCTGTATTACAGAACAAAGTTCAAGA
ATATTTATGAAATTCACAAATATCTATCACCCAATAAAGCAAATGTACAATGACTGAGAT
CCTATAAAAATTACCAACCTATAAAGAAGTATACAGTAGAAAGTGAGCCATAACAGGGAG
GACAATATATCAATTGAAACTCACAGAACTGACATAGATGATGGAAGTAGAAAAACAGCA
TCAAAATGGTCATCTTAAATTGTATCTCATATGTTCAGAAATATAGGTGAAAGATTAAAC
ATGTTAAGTAGAGAAATGAAAGACGTAAAATGAACCCAAGAGCATGGTAATGGGTTCATT
GGGGGCCCTTCTCTGTGGGCTTTATAGCATACCCAAGCCAGTGTAAACTTCAGCCTTGAA
CGATTGCCCACCCTCCTTCCCATGGGCTATGAGTACTGAAGGGGGTTGCCCATTGTCAAA
CAAGCAAAAACATCCAAGTTGAGCTTCTAGAGGTGAAAGTTATAATTTCTGAAATAAAAA
TTACACTGGATAGGTTAACAAAAGGTAAGGCATTGCAGAAAAAAATCAATAAACTTGTGG
ACATAGCAATAGAAAGTATCCAAAATGAAACACAGAGGGCAGGCCAGTCATGGTGGTTCA
CACCCGTAATCCCAGCACTTTGGGAGGCTGAGGTGGGCAGATCACAAGGTCAGGAATTCG
AGACCAAACTGGCCAACATGGTGAAAGCCCATCTCTACTAAAAATACAAAAATTAGCTAA
CTGTGGTGGTGAGTGCCTGTAATCTCAGCTACTCAGGAGGCTGAAGCAGGAGAATTGCTT
GAACATGGGAGGCAGAGGTTGCAGTGAGCCAAGATCATGCCACTGCACTCCAGCCTGGGT
GACAGAGCGAGGCTATGTCTCAAAAAAAGAAACATAGAAAAAATTTAAAAAGTGAACAGG
GCATCAGTAAGTCATGGGTATAATATACAGGTACTAGGGATTTTCCAGGAAGGGGATAGA
AAAAATACATGAAGAAATAATGGCTCCCAACTTTTCAAATATCATGAAAATGATAAACTC
TCAGATTCAAGAAACTCAGTGAAACATGAAGAAAATGACACCCAAATCCATCAGCATCAA
ATTGCTCAAAGCTAGTAACAAAGGGAAAAACATCTGGGGGATGAGGGGCACAGGGAATGG
AGACATTACATACAGAAGAACTAAGAGAAGAATAACAGCAAATTCATCTTCAGAAACAAT
GCCAGCATGAAGACAATGGAGTAACATCTTTAAAGTACTGAAAGAAAAAATGTCAGTTTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved