Macaca_mulatta Locus Mono:115:SNORD55
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:115:SNORD55
Macaca_mulatta
Mono:115:SNORD55
9
SNORD55
1001..1080
2080
CAAATTATAGGATGATAGAATACTTTACCTTTCCCCACATGTTACAAACACATTAATAG
GTCTTTTGTATAATAAAAGTGTAATGTAACTATGTCTCAGAACTTATTTAAGAGGAAATC
TCTAGAAAAGCCTCAAAACAATAGGGAGACAAAAACAGTACATCAGAGAAAATTATTGCA
TCTGACATCTACAACTGTAGCAAACAATAAATACAACCTAAGCCCTAGCCATTTAAACAT
AAAGCCTCACACTCCATGCCTACGTAGTTCAGTTTGTTTTACCCAATACATCATATCTGG
CTTTCAAAAAATTACAAGACGTACTAAAAGACAAAAAAGACAGTTTGAAGAGACTGAATA
AGCATTGGAACAAGACTGAAATGTGGTAGAGGTGTTCAAATTATTGAACCAGTAATTTAA
AATAACTATAATTATGGCCGGGTGCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAG
GCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAAATCAGCCTGGCCAACATAGTAA
AACCCCGTCTCTACTAAAAATACAAAAAATTAGCTGGGCATGGTGGTGGGCACCTGTAAT
CCCAGCTACTTGGGAAGCTGAAGCAGCAGAATCGCTTGAACCCAGAGGGTGGACAATGCA
GTGAGCTGAGATCACGCCATTGCACTTCAGGCTGGAAACAAGAGCCAAACTCCATCAGAA
AAACAAACAAACAAACAAAAAACCACTGCAATTAATATGTTAGGCATTCTACTGGAAAAA
GTAGACAATATGCAAGAGTAGATGGGTAATGTAAGCAAAGAGATGGAAACTCAATATTGT
TAAAATATCAGGAAGAATGAAAAAGAAATACTAGAAATAAAAAACACTGTAACAGAAATA
AAAAATACCTTTGATGGTGTCACTGGTAGACTGAACACAGCTGAGGAAAAAAAAATCAGT
GAGCTTGGAGAAGTTAATCAAAACCTCCAAAATTGAAATGCAGCGTATGATGACACCTTG
GTAATGCTGCAGACTCCTGAGTGTGCAGTGAAGAGGTGAACTTTGAAAAGTCACATATGT
GAAAAAAAAATGCACAGAGCGAAAAATGAAAAATACAGAACAGAATACCTAAGAACTGTG
AAACAATTACAAAAGGTGTGACATATATAATAAGAATACCAGAAGATGAAGACAAAGAGA
AAGGAATCCAATGAGATATTTGAAATCATATTGATTGAGAATTTCTCAAAGTTAACACCT
CCAAACAACGGACAGGCACCAAAAAAAAAAAAAAATCAACCCTTAGGCATATAATGTTCA
AACCTCATAAAATCAATAACAAACAAAACTGAAAGAAACCAGAGTGTTTGGGAAGCACCT
TCCCTGTAGAAAAGCAAAGATTAGAATTACATCAGACTTCTCTTCAGAAGCCATGAAACA
AAAAGAGAGTAGAATGAAAATATTTAATGTGTTGAAGAATAAAAATAGCCAAACTAGAAA
ATTTTGTATCTATGAAATTATGCTTCAAAAGTGAAGAAAAATTGAAGACTTTCTCAGACA
AAATTAAAGGAATCTGTTGGCAGTAAACCTACCTTGCAATAAATGTTAAAAGAAGTTCTT
CGGAAAGAAGGAAAATGCAATAGGTTAGAAATTTGAATCACATGATAAATGTGGATCATA
AATAAATATATTTCATTTTTATTATTCATGATTTACACAACATATATCTATTTGTTTAAA
ATAATAAATAGCAACAATATATTCAGTGATTATCACTTACTGATAAATAAAATGAATGGC
AGCACTGTTACGAGATAGAGGAAGGGGGAATTGAAAATATCCTGTTGTAATGTAACTACA
GTATCTATGACATGGTACAGTGTTATTTCAAAGAAGGCTTGGATTAGTTGTAAGTGTACA
TTGCAAACTTAAAGGAAACCACTAAAAAAGTAAAAGTGGTATAATTGATATTGATAATTG
ACATTTTGAGTCTGATCTTCCAATGGGAGAGATACACAATGAGCAAATAAATAATAAGAT
ATGTAGTATATTGAATGGTATTGTTATGGAAAAATTAAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved