Macaca_mulatta Locus Mono:154:SNORA64
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:154:SNORA64
Macaca_mulatta
Mono:154:SNORA64
11
SNORA64
1001..1139
2139
GACATTTTTGGTTGTCACAACAGATATGAAACCTACTGTATGTAGTAAACAGAGACCAG
GGATACTGCTACACATCATACAATGCACAGGACAGCTCTCACAACAAAGAATTTTCCAGC
CCAAAATATAAATAGTGCTGAGATTAAGAAATCCTGCTATATATAACTAAGCAGTGTGTC
CATTCCCAAAAGGTGTCATGGTTATACAGTAAGTATTTTAAGTGCAGAGGCCTATTACTC
TTCCTTTCCAAGGCTGCTATATTAATGAATATCACCAAATTATAAACATTTATAGCATAA
CATTTGAAATGATTTGAGCCAATGAAGTTGTCTGCAACTCAGGAATCTTTAAGAGTAGAG
GAAGTATCTAAATTTAGCCACCAATCCTTAAGTCCATACCTTGTTAGTAATTTTGTTTGA
AGCTTATCCTCTAGGAAAATTCTCAGTAAGAGCTCAAAGGGAAAACATTCCCTGAGGTGT
GTGTTTGTTTGTTTTTAACACATCAGTAAGATTCTTCATGGGTTTCACACTTGAAATTCA
TTTGGCTACATAGAAATCCACACATTACCCCTTGGCTCACATTTTCTTTCCTTGAGTATC
TTAAATACATTATTCCATTTTCTTCAGGCATAAAGCAGTGCCGTTTAAAAGTCGGATGAC
AAACTTTTTTTCTTTCTCAGTTATTCAGTCTTTTTGCCTGGTGCCCAGTAAATTGTTTTT
GCTTTAAAGTTCATTGATTTTATGTGCATTTATATCAGTTGTCATTGTTCTGAGTAAATA
TTTTTAGGTATACAGTGTGCTGTTTCAACGTGTAGTTTCAAATTTTTTTTAATTTCAAGA
ATGTCTTATTATAGCTTTTAGAATTTGTTCTGTTTCCTTGGCATGGTTTTCTTCAGGGAC
CTGTATTATCCATATATTGCATTATCTTTGTTTTCAATATTGTTTTCTCTTAAATCTTTT
AGCAGTCTTTTTTTTAACAACAACAACAAAAAAACAATTTCCTTCCCTCAGCTCTGCATA
ATTAAGTTATACTTGGCTTCACCCATTTGACTTCTGCAACAGGGAGAGAGAGAAAAGATG
TCCGTGGCGCATCAGATTAGCCTTATGGTGGTCTCTCTCTCCTTGAAGGGCACAACAGAT
CCTGGGTGAAAAAGAAAACAACAATTTCCTTTCTTCACTTTTTATCGCTTTACACATTAC
CTGTGCTTTTTTTATTCACTCTTGAATTTCCACTAAATTGAGGCTCATTTCTGAAACTGT
ATATATGTATGTTTTTGAGATAGAGTCTTGATCTGTCTCCAAGCTGAAGTGCAGTGGCAC
AATCATGGCTCACTGCAGCCTCGAACTCCTGGACTCAAGAATCCTCCTGTCTCAGCCACC
CAATAAGCTAGGACTATAGTCATGCACCACCACAGCCAGCTAAATTTTGTGTACACAATT
TTCCTATTCTTTCCCGAATTCTATCACCTTATTTCCGAGTTTTTAAAATTCCTATTTATA
TTTTTATGTTTTCTTTCATAACATTTTCTTAATTTCTTTTAGCTTGTTTTGAAAGAACAG
GTAATAGTACTCATTTGTTTTGGGGGCATGTCTTTCTGACTTGCATTCATGATCTTTAAG
ATATTACTTTGTTCCTTTTTTTCTTTTTCCTTTATATTAACTTTCTCTCAGATTTCACTT
CTAACATTTTCTGTTACTAATTTTTAAGTGAAATCAGTTTTTCTGAACTTCGAGATGGAG
GCATGGTCATTCTGTTGTTTTTGTGTGGTCTTCAAAAAGCAGCTTGTTTTCACAGATTTT
TCTGGTTGTGTTCTCCTCTCCCACTCATCTGAATCTTCTCTTTTATCTCTATTGTCCCTG
TAGTGCTCAATTTGGACTGCATTCCAGCATTTTCCTCCTAGTTTGGGTTTTATCCCTAAA
GGGAGCTATGGCTGCATAGTTTTGATACTTCATAATGCCTAGATTATGTATCCCCTTCTA
CTTTACAATATATTACTTGTACCCATTCTAATTCCACTTGCTTTTCTGAAATCAGCCCAC
TGTATTTTCTAGTAAGTAGATTATTTTGGGGTTTTCATATTTTCTGGTCCGTCAGACAAT
CCATTGTTTCTCCATGCTTACTCCCTCATAGAGTCTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved