Macaca_mulatta Locus Mono:332:SNORA24
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:332:SNORA24
Macaca_mulatta
Mono:332:SNORA24
5
SNORA24
1001..1131
2131
CTCAAGCGATTCTCCCACCTCAACCTCCCGAGTAGCCGGGACTACGGGCGTTCACCACC
ACACCCGGCTAAGTTTTGTGTTTTTAGTAGAGACGGGGTTTCGCCATGTTGGCCTGGCTG
GTCTCCAACTCCTGACCTCAAGTGATCCGCCCGCCTCGGCCTCCCAAAGTTCTGGAATCA
TAGACGTGAGCCACAGCGTTCGGCCCCTTTTTCTAATATTGTCTAAAATAAGTATCCTAA
ACAGGAAACACCAAAAGATCCCCTTGCTTCCGTCACCTACACGGGTAATCGTCATGATTT
TTCGCTATCGCGAGAACCTTTTGGCTCTCGTATGTGCGCATGCGTCTGGATCCGGAGCCA
GGTGACCCGCTCAGACGTGGACGAAGGGCGGGGAAGAGGGTAAAGGAGCCCGGGAGGAGG
TGGCCGACGGAACAGGTGGAGCCGAGGCGGGGCTGGGCGGGGCTGGGCGGGGCGGAGAGT
GAAACAACATAGGCTCCGCCCCTCCTGGCGCTTCCCCCGGAATAGCGTCATCAGTTCTAT
AAGAGAGCATGTGTCGAAGGCCTCAGCCTTTCATGTTCGGGAAGCGTCGGGGTTAGGTGA
AAGTACCCAGTTGTCTTTCGTACGTTAAAATGATAATTGGGCTGAAACTTACTGCCTTAC
CTAAAGGGCAGCGCAGTCAGGATATTGGTAGGTCGGGGGGCAGCTTTGGAAACCCGTAAG
TTTACAAGCATGCGCGGACTTGAGTGCTCATTAGGTCGCGGGGCGGCCACGTGCAGCCCT
GGACCCTGAATCCCGGCGTGTGTGGGCCGTGGGCCCTCGGGGAAAGGTTCCGTGCGCCCG
GGGACTCCGGTGAAGCCTGTTTCGCTGTCGGTGTCTTGTGGCCATCTTGAGTCTATTTTG
TCGCTCTTGTGCCATAGCACCCCGAGAACCGTCAGTTTGAGCCAGATGGTGAGTAAATAA
CCTGTAGCAGTTTGCTTGCTGGTTAATTCTGGATTGTGAATCTCCATGTATCTTTGGGAC
CTGTCAGCTGTGGCAGTCTCCCTTCCTAGCCATGGAAGAGCATATTCTTGTTTATTGGCA
AAGCTGTCACCATTTAATTGGTATCAGATTCTGACTTGCACAAGTAACATTATTCACTGC
TAAAAACCTGGAGGGTGCCGGATTATTGGGCGAACTTTTCTAAACCGTTGTTCAAATGTT
TCTAGGAAGCTGAGCTGAACACATTACGATGGATGATGGAAACATAAGGTACATTTTTTT
TTTCATATTCCTGAGTTAATCTGAAACGCCTTAGCGCCAGGACGTTGGAAAGCTAAAGCT
GGCCCGTTTTGCTGGCTTTTGTAGTTTAAGAGTTACCAACCAACTGAATTAGCTGATAAG
ATCTCAGAACAGTGGGATAAGTACACAGCTCGGAGTTTTATAATGTTTTTTTTTTCTCTT
GCAGACTATCAAGAAATCCAAAGTGGTAATGGGCAAAGTCTGTTCAGCATTCGGCAATGG
ATTTATCTTAATTGGGGAAACGGTGTTCCAAATAATGTTCTGGAAGTTATCAGGATACCT
ATTTTGAATATAGGACTGAATTTTTTAAAGTAATATTTAAGGTGGTCCTTGATAATTAAA
TAAAATGCTTAATTCATGTGGCTACTCATTGTTCCTTGACTGAGTGATTAATAGACGGAA
AAGTAGTTAATAGTGAGCAGAATACCTCCTGTTTAATGTTACGCATTCACGTGGAAGTAG
TGTGAATGAGTACAGTTCTAAGGTTATTGCAGCCTTTGTGAAAAATGTAAAATATAAAAA
TTACCAGGTTACCCCCAGGGGAGAGAACAGTCTTTTTAAACCATACAAAAATTTAAGGCA
GCTATACAAGGTGAAAAATTATGTACTTTATTTACACAGATATGCACAGAACACGTGTAT
CTTTCAAGTCACAAGACGGTTACAGTAAAAGCATGTTATATGAACCATGTATTCTTCAGA
ATTGAGCAAATTGCAGGCTGTTGACTGCCTTTTAGGTTTGTCGGTCCCTGATCTACTTGA
AACATTGATGTTGCTTGCTCCAGCACTGTGGTTTAATTATAAGGGCAGCCCGTGAGAAAG
TTTCAATAGACATTTTTCTCACCTATATTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved