Macaca_mulatta Locus Poly:15:SNORD25
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:15:SNORD25
Macaca_mulatta
Poly:15:SNORD25
14
SNORD25, SNORD26, SNORD27, SNORD28, SNORD29, SNORD30, SNORD31, SNORD22
1001..1069, 1266..1339, 1551..1622, 1945..2019, 2666..2730, 2902..2971, 3237..3305, 3595..3720
4720
CATCCTACCTAGCTCTTGGGATTTTGATGGATTAATCGATTAATACAGTGTGCTTAAGA
CGGTGCTCCACAAATGTTAGCTAATGCTGGCCCGTAGTAGTCCAAGATCTAAAGAAAACG
CACCAGAAGGCAGGACATAGGGGACCAGTTAGAAAAAAATCAGATCCTGTCTTCAGTGGA
GCACTTACGCCCTGACTTACTTTACCGAAATGGCTCCCCCAAAGGGGACCTCCTCCCGAG
TTTAGCTCGGGATCCAGTACCTGAGTCATCCCCCGCGCTGAGACCCTGGACACCAGCCTC
CGAATGTGAGCCCGGCAGCTGGCGGGGAATCGAAACGACGGCGGTCGAGGCTTCAGGAGG
CTGTAGCTCCATGGAGGCGGATCCTGCACACAGGTTTCGGGTGTGTGGGGGGAAGGGGGA
GCTCAGAACAGGGTTAGCGGGTAAGCAGTCGTGACCGTCAGTCCAGGATCCGCGTGAGGC
AGTGATCTCACCGCTCCTGCCACATGCACTGGGTGAGAAAACTAAGCCGCAATGCGGTCG
GTGAGGTTCCGTAGGACGCATGCGCGCCCTTTTCGCGCCGCAAGTTCAGGTAGCGCTTTG
TCCACGCCCTCCTTCCCTGGAACTCTCTACCCACAACTCCCCGGGGTCGCATGCGGTCAA
CGTATGCGCGTGCGCTCGCCATAGCACCGCCCCCAAATCCCGTGGGCCTCTGCGGGATGG
TATTTAATCGTCTCTCCGTGCCAATTTCGGTCTCATTGTTCTACTGCCTCTGGTAAGTGA
TTTCGTAAGATTTGTAGCTGTCAGTGTTTTGTGCTTTGTCCGTTTCTTTTATTTTGAACG
ATTGTGCGGACATCGCATAGCACGCGCTATGCCTTCTGTGTTGTAGCTGTCTAGCCAGGG
TGACTGGCGGGTGAGGTCTTGTGGGTGGCCTCGAGACTTAAATTAAGTAGCAGCGGGGCT
TTGTGAAGGACAAGATGGCGATGGCGGGCCGTGCGGGTCCCCTCCCTATGATGAGGACCT
TTTCACAGACCTGTACTGAGCTCCGTGAGGATAAGTGACTCTGAGGAGATGGGCCCTGCA
AGCCTCCTACTTAGCCGTCGGCTCAGAAGATAGCGTTTTCGAAATGCCCTGTGTTGACCT
AATGTCTTCTTGGACTCTTGTCTGCAGGGTTTACGCGCACGTTGGAATCGAAGAGAGCTC
TATGTTACAGTAAGTTCTTATGGCCATTTCTTAACCTCTGCTCTTTCGTTGAGTGTGTAG
AAGTTGCTACGGGGATGATTTTACAAACTGAACTCTCTCTTTCTGATGGATTAGTGGAGA
AAACAAAAATTCTGAGTAGCACTGTACTGTACGCAATAAATGTCAGGGACTTATTGATTT
GTCTGAGGTGTTAGTGAAGGCTGTTATTTTTTTCAGATGTTTAGCCCACAAAAGCTCACT
GGTGAAGGAATGGGACAAGACCCATCTTTCTGCAAAGCCAGCGTTACAGTAATGTTCCAG
GTAGGTGTACATGCTTTTATGCTCTTACAGAGGAGACCTTGCTAGATAACCACTCCGTGA
TGAACACAAAATGACAAGCATATGGCTGAACTTATAAGTGATGTCATCTTACTACTGAGA
AGTGACAGCGAGGTCTTCGGGGGTCTTTGAATGACTATTTTTAGGTACATAAAATGCCTT
CCTCTGTTGTCTACAGCATCTCATAATCTATCCTGAGGAATTCAGCTGCCTCCCAGGGTG
AATACAGGTAATTATTCAAATTGGTGTATGTCATCTCTGTAAATGTTCACAAGAGAACAA
GTGGCCGGCGGAAGCAATTTTGTTTTTTGGCGCCTTCCATCTTGTTCCTCTTGAGATAAT
TTTCTGGGAAGCGAGATCGCAACCCGGTACTACAGTTCTTGTAAAGGTGCGCTGTTAGCC
TCATCCATATATCGATCACTTTACTGTCAGATGATTTGAATTGATAAGCTGATGTTCTGT
GAGGTACAAAAATTAATAGCATGTTAGAGTTCTGATGGCAGTTGTTGATTTTGAATAAGT
TTCATTCCATCCTAATACCTTAAAATAACTAATTTGCTTTGCTTTCCAGGTATTCCTCAT
GACAATCTGCCTCTATCTTACAGTACGTTGCTTTTTTAATTCTATGGGCCTATTATCTAA
TTGATAACTTAGCCATCTTGATGTTTGTTACCAAAGCCTGCTTAAACCATAAAGTTTTCT
GGTTCCTCTTGTTCTCTGTAGTGATGTTTCCAGACCTCCCCTTTTTTCTCTCAGATAGAT
GCCCACTGATCTGCCCAGGGTCAGACTAGTGCTTGTCAGTTGTAGGTTTCCACGGTTCAG
CTCCAACGAGGAGGAAACATCCTGCCTCAGCCCTGTTCTAGCCTGGGAACCAGTAATTGT
GAACCCACCAGGATTAACTGAAAAAGGGCATGAGAGCTTATTCCATAAGCTGTCTGAGGC
ATTTGGTTACCTTTTCTTAGCTTGTCCACTAGCAACCGTAACTAAAATAGTTTTGGCTGT
TTGGGATAATTAGCTAATTGATTGATTTTTTTGATTCAGGAGCAGCTTGTTGCCATATAC
TATTGAAAAACCTTCAGAGCTGAGAGGTTAGTTGATTTTTTTTTTTTTTTTTTTGCTCCT
TACCGCTTATGCCACCAAGTAGACAGTTTCTATGATGAATCAAACTAGCTCACTATGACT
GACAGTGAAAATACATGAACACCTGAGAAATTGGAGAATGCAGGGAGTGGGGGGTAACCA
TGTCTGAGGAATCTTTCACCCACAGTTTTGTTTTTCTCTAGGTGTTATTAACCAATAACC
TCTTTGGCTCTAAGGTGAGTAATTTCACTGTATTCAATGCATCCAGCATATAGAGTAGAA
AAAACTGCCTTTTTAGGCCTGTATATATGATGACTTACATGGAATCTCGTTCGGCTGATG
ACTTGCTGTTGAGACTCTGAAATCTGATTTTCTAAGAATGATGCGTGGGAACAACTTAAT
GCAGGATAGGAGAAGCACTACTGACTTGGTCTTCCTCCTTTCAGGGCCAGCACCTTCTCT
CTAGCACTCGAGGAGTTTGAGGTAAGTGGCTTTGCAATAGCTGCCATCAATGGCTGCTAT
ATACAATTTTCTGTGATTTTTGTGTGTGATAGCACTGTGGTCTGGGTGGATGTGTACAGA
TAGAACTGGCTTAACCCAAATCTTTGATCTCCTGGACCACCAAGTGATGATCACCTGCTC
ACCAGTGATGAGTTGAATACCGCCCCAGTCTGATCAATGTGACTGAAAGGTATTTTCTGA
GCTGTGAGCCTGCCTTCCAGTGACAACTTCTAAAAATTACAAGTTATTTGAGGAGGCATT
ACAGCCAATAGGAAGTTCTTGGGCTAAGTAGTGTTTCCTCTAAAATGTGCCCTGAAACTT
CTGTCTGCCAAGCAACAGATATAGTTGAGAGATTGTAAAATGTACTGTAGAATGAAAGTC
TCTCAAGACTACATGATTTTTTCTTGATTTTGCAGGAAAACTAGGTGTTACTGTTGACTC
CAGACTGCAGTTACAGGTGAGTAAACCGAAATGTAAGGTGGACTGTGCTAAAAATTCCCA
ATGAAGAAACTTTCACACGTCTTACTCTCTGTCCTAGTCCCAGAGCCTGTAAAGGTGAAC
CCACTGGGACTGGCTGGGGGAAAAGAGGAAGATTTGTTCCAGAAGGAACTGTCTGAGGGA
TGACAAATATTTCTATACAAAGAAAGGGAGTAATCAGCACTTGTTGAAAACATTGATTTT
AATTTTTCCAGGTCTGAGTAAAGAACAAGGTGCATAAGAAATGGTAGGTATCTGTTTAAA
TATTTAACTGGTTTTATAATAGCAACCTTTTACTCTTAGGTTACATAGTGTTAACTATTG
TGTACATTCATATTTTCCAATCCAATAAGAACTTTTGTTTTTCCTCTGCAGGAATCTGTC
TTGGAGGACATCAGAAGGTGAATTTTCCAAGTCCTTGGATAACCTAGCTGTTGAAGTTAC
CACAGCATAATTTTAGTCGTCTTAATGGCGTGGCTGCTTTTTTTTTTTCAAAGCTTTACT
GTGAATCATGCCTTTGGGTGGGTCTACCTGGGCACAAGGAAGTGACCCCTTGAGAGTTTG
CTATTTTTAACTGGGTTTTACCCAGCTTGCTTAGGCAGTCTGTCTAATGCTGCATTTCCT
ACTCCAAGGCAGCATTCAAGGAGCCTAATTTATCAGCACACTTTAGGGACTTTTTCCCTA
GATGTACCTCACTGAAGGAATTTTAAATGAAAAGCTTGCTGGGTTTAGGGGGTCTTTTAG
ATGTACCTTAAAATGTTAGCAGACACAGATTAAGACACTGGGAGCCAATGAAACAGTTGA
GGGTTTGCTGTGTGTTGATGTTTCTGTATTTTATCACCCCCTTCCTGCAACATTATTTCT
GTGGAATCTACCTGCCCTTTTGTTTTTTAGATACAAGGGCTTGGTTTTACTACCAAGGCT
GCACTCAAGGCCCCGGCTTTAAGAGATCCTCCCACCACAGATTTCCAAAGTGCTGGGATT
GTAGGTGTGATTCTTGGCACCCAGACTTTGCTGCCTTTCTTACATGATCCAAGCCCAGAA
CCAAAACTCAGGCACTGCATAGATGGCCAGTTTGGCAAACTACTGACCTAGCTTGTTGCC
AATTGTTGATTGAGCTTCCCATAACTCCATTTCTGTTCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved