Macaca_mulatta Locus Mono:53:SNORD41
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:53:SNORD41
Macaca_mulatta
Mono:53:SNORD41
7
SNORD41
1001..1069
2069
GCTGTGCAGAAGCTCTTTAGTTTAATTAGATCCCATTTGTCTATTTTGGCTTTTGTTGC
CATTGCTAATATTCCTAAATTATATTTAATTTCAAACATTCTAAGACATCACTCTGTAAT
GAATGTAAAACCACTTTTGTTAGAGAGTATGATACCAGTAGTTCTATTTAATCTTCCTTT
TAAACAAATACATATTTATTTTAAAACGTGGGTTTTTAATTATTTGGTTAAATTTTCAGC
ACTGTGTTTAATAATCCGGGATACCAAAAAAAAAAAAAAAAAAGCCTGAGGAATTTATAG
TCTAGATATGGAGAAAATACCTATACATGACATGATTAAAGTACTTTTAAGTAGAGTGTG
CAATGAAATTTGAGGTAACAAAATACAGGGTAACTGTGAGGGTGAAATTGACATGGAGTC
ACAACAGTCAGGGGACATTTATGACGGAAGAGTGTTGGTGAGATTTTGATTGGTGCTTCC
AGGCAGAGGGAGCAAGACAGCAGGCCTGGAAGCAGTGATGAGTGGGGTATGTGGAGGACA
CTGTGAAGACTGGCCTGCAATAAAGTTTAACCTGTAATTCCTTTATAAAGATTTCCACGT
AGGAAATTAATCACAGTTATATTCACAGAGGTTAATTACAGTGTTATTTAAAATGATGAA
AATTGGCCAGACGTGGTGGCTCATGCTTGCAATCCCAGCACTTTGAGAGGCCGAGGCAGG
TGGATCACCTGAGGTCATGAGTTCGATACCAGCCTGACCAATATGGTGAAACCCCGTCTC
TACTGAAAATACAAAAATTAGCTGGCTGTGGTAGCATGTGCCTGTAGTCCCAGCTACTCA
GGAGGCAGAGACAGGATAATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCCTAGAT
CACACCACTGCACTCCAGCCTGGGCAATAGAGGGAGACTCTGTCTCAAAAAAACAAACAA
ACAAAAAACCCCAAAAAAACACCAAAAAAGATGAAAATTGGAGGGAAGTGATGACACCTT
TGACTGTTGTGTGACACTGATTTCTCTCGTATTCGTACTGGCTGATCCTGAGGTGAGTCA
AAAAAAGACAAAAATGTATAAAAATAAAGAAAAATAAATAAAATGATTAAAAATGGAAAC
AACCTACATTTTATTTTATTTTTTTATTATTATACTTTGAGTTCTAGGGTACATGTGCAT
AACGTGCAGGTTTGTTACATATGTATACTTGTGCCATGTTGGTGTGCTGCAGCCATCAAC
TCGTCAGCACCCATCAACTCTTCATTTACATCAGGTATAACTCCCAGTGCAATCCCTCCC
CCCTCCCCCCTCCCCATGATAGGCCCCAGTGTGTGATGTTCCCCTTCCCGAGTCCAAGTG
ATCTCATTGTTCACTTCCCACCTATGAGTGAGAACATGCGGTGTTTGGTTTTCTGTTCTT
GTGATAGTTTGCTAAGAATGATGGTTTCCAGCTGCATCCATGTCCCTACAAAGGACACAA
ACTCATCCTTTTTTATGGCTGCATAGTATTCCATGGTGTATATGAGACACATTTTCTTAA
TCCAGTCTGTCACTGATGGACATTTGGGTTGATTCCAAGTCTTTGCTATTGTGAATAGTG
CCGCAATAAACATACGTGTGCATGTGTCTTTATAGCAGCATGATTTATAATCCTTTGGGT
ATATACCCAGTAATGGGATGGCTGGGTCATATGGTACATCTAGTTCTAGATCCTTGAGGA
ATCGCCATACTGTTTTCCATAATGGTTGAACTAGTTTACACTCACACCAACAGTGTAAAA
GCATTCCTATTTCTCCACATCCTCTCCAGCACCCTGTTGTTTCCTGACTTTTTAATGATT
GCCATTCTAACTGGTGTGAGATGGTATCTCATTGTGCTTTTGATTTGCATTTCTCTGATG
GCCAGTGATGATGAGCATTTTTTCATGTGTCTGTTGGCTGTATTAATGTCTTCTTTTGAG
AAGTGTCTGTTCATATCCTTTGCCCACTTTTTGATGGGGTTGTTTATTTTTTTCTTGTAA
ATTTGTTTGAGTTCTTTGTAGGTTTTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved