Macaca_mulatta Locus Poly:11:SNORD99
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:11:SNORD99
Macaca_mulatta
Poly:11:SNORD99
1
SNORA16, SNORA44, SNORA61, SNORD99
1001..1135, 1534..1665, 2153..2282, 3153..3230
4230
GGAAAGCCTCCGGCGGTTCGCGCTTCGCGGGCTGGGGATGGAAACGCGCGTAGGGCTGG
GGAGGTGACGCGCGGACAACGCAGGGGCGAGCAAACTACAATTCCCAAGCAGCTGTGCGC
CACGCGCGCGGCCGACTGTCGGGCGTGGCCGCGAGGGGCAGCCTATATAAGCTCTTGCAC
GCAGCTGCAGCGCCCTTTTTCCCCGCCGCAACCTTGTTGCGGGTTCACCATATTTAAGGG
TCTTCTTACCTCCCTGCAAGCCATAACCCGCTAGTTGCTGCTACCAGCCCGCACTCGCCG
GGGCTTTCTCCCAAGGCCTCGATATGGTGGTGAACGTGGCACGGAGGAGTCGGACCTTCC
TTCCCAGTGGGCCCGAGCTCCAGAAGGGACCCTCGGTCTTGAGAGGGGTCGGATCCCGCT
GGGGCCGCGCCCTTCTCTCGCTTCGGCCTGCGCAACTCTGCGCTCTGGGCTGACAGGTGA
GTGTTGCCGGCAGGCGGCTGGGTTTACGGAAGGGGTTTTGGGACCGGTCTCCTGGGGGAT
GCGGGGATGAAGCCCTGGGCCTGAAGTGTCTTAATTTGGGGGAGGCCGCATGCTGGTGTC
AGGATGGCCTCCAGTTGAATCTATGACAGTTACCAGCTAGGTGATTTTGGGACTAGTGAC
TGCGCGCGAGGCCTCTGGAGGTCGCCCTCGTGGACACGCTTTTCAGAAGGACGGGTTTTA
GGCATTCAGACCCTTGTGTGCATCCCGGCTTGTTGCTTTCAGCCTCGCTAAGTGACTAAG
CGACCTTCAGCAAGTAACTTAATCGGTCTAAACCTCTTATCTGTAATAGGCGGATAAAAA
GATCCCATCAAGATTGAGAAAAAGCACACCAAATATTGGCACAGCGTGGGCAGTGGGGCT
ACAGGATGACTGATTTAGTCAACAGATTCCGGCGCACTTCAGCAGGTAGTAATGATGGAC
AGGTGAGGCTTTAGGTGGCTGCCCTGGGATCTGAATTGCCCCTTGGCCCTTATCGAAGCT
GCAGCTGCTTCCGCATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTG
ACGGTCGCCGTTCTGTTTGTTGTAACTGATCTGCAACATTTTGGGAAAATACAGTTCCAT
TATACTTGCTATCTTTCAGCTGTAGCCAGAGACCTTTATCAAAATGGGCCTGTTTCCACA
GACCAGCAGAACGGTTGGGGGTTTGCATGTACAGTTAACCAGCATAAGATTCCCGTACTG
GGAAAATCCAGCTGGGATGTGACACAGCTTAACTGATAGCATCAGTATTCGGACCAAAGG
CTGGTTAGATTTGTATCGTTCTGAGAACCAAATGATGGGACCAATAAAATTGTTCTTGAC
AGTTCTCATTTTGCTGTCCAGATGAAGACTCTGAGATGACAGAAGGTGATCTGTCTGGTG
ATCAAGGACTCCCGGGGTCACATCAGTGATGAAATGCAGGGGACCTGGTAGGTTTCTTTT
GGAGACTGACTGGGGGCTCCCTGGTGGGACAGAACAGCATGTTTCCAAGGGCTGTGGCTG
GTGGTAGCCATGGGATCTCCAACTGCATGCAAGAGCAACCTGGAAAGACTTTGACAGCGC
AGGTCAGTACAATACCTGCAAGCTGCCACTCAGCTTTCCTATAATGTTTCAGGACCAGGG
CTGGAAGCCTTCCACGTGTCAACTTCCAATGTAGATGGGTGTTTTTTTTTTTTTTTGAGG
CGGAGTCTCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCACGATCTTGGCTCACGGCAAC
CTCTACCTCCTGGGTTCAAGTGATTCTCCTGCCTCAGCCTTCCGAGTATCTGGGATTACA
GGTGCCCGCCATCACACCCAGCTAATTTTCTTGTATTTTTAGTATAGATGGGTTTCACCG
TGTTCGCTAGATTGGTCTTGAACTCCTGACCTCAGGTGATTCGCCCCCTTGGCCTCCCCT
CCCAAAGTGCTGGGATTACAGGCATGAACCACCACTCTTGGCCAGTTTAGCTTTCACACT
AAGCTTTTTGTTCTGCAGGTTGCCCCAAGTTTCCTGGCCGTGTGTGATCCTGAGGAGGTG
AGCTTGTTTCTGGAGCTGTGCTTTAAGGTAAAGTTGATGTGGAACACAGCTTAATCCTCC
TGTTCCCTTTCCCATCGGATCTGAACACCGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTA
ATAGTGAAGCTGGCCTGAATGTGGTAATCTGGTATATGGCATGTGGGCTAGTTTCAGACA
GGTTCAGAGATGGTTGGATCTCTGAAATTGTAAAATGAAATATAGGCTAAGGGAAGGATG
TGTATGAAGCTCTGGAGGTTGGTATAGTAATAGCATTTGGGAGGGATCTGTCATAGCTTT
CTTGCCTCTTAATTAAGGTGTTACTTTCTTTTAGATTCATGTTACATGCAAAGCTGTCCT
CGTGTGACTATGGACCTATGGAGTTGGGTAAGTTAGTGACCACCCGAAGCTCTGTCAGCG
TGTAGCTGCAGGTAGTGCTCAGTTTTCGGGGATCTTGTCCTAAGTAGTCAGCCTAATAGA
ACTATAAGGTTACTTAGGTCTGTGTCAAATTTTTTTTTTTTTTAAGACAGGGTCTTTCTG
TCACCCAGGCTGGAGTGCAGTGGCACGATCTTGGCTTATTGCAAACTCCGTCTCCCAGGT
TCAAGTGATTCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTATAAGCATGCACCACTAT
GCCCGGCTAATTTTTGTATTTTAAGTAGAGACAGGGTTTTGCCATGTTGCCCAGGGCAGT
CTTGAACTCCTGACCCCAAGTGATCTGCCTGCCTTGGCCTACCAAAGTGCTGGGATTACA
GGCATTTCAGTAACATTTACATTTGGCCTTCCATTTACATTTGGCCTTCCTCGTGTGCCC
TGTTTGTTAGCTGTTCATTACCAGAGGGCAAAGGTGCTTAGAACATGATTTGCCCACCCT
GCAAGACCACATATTGCTGGAAGTTGAAGGCAGCAGAGGGCACCGTGGGCCACAAGGCCT
GGTAGCCGCAAATGTTCAGTGGTGGCTGGAGCTCATGATGCATTCTTTGGTAGGACTTCA
AGGGGTTCCATGTAGCACACACTATTTAGAATGACTGGTCCAGGATGAAACAATCTGAGT
GGACATCCATGGATGAGAAATGCGGATATGGGACTGAGACCAGCTCCTAGGAAAATGCCT
GGGTGTGGGGGAAATCTGGGAATTTCTAACACAATGGCTTATACTTCCTTTGCAGGAGAA
TCTCTACGGGAAGCAAAAGGCAAGACCCCGGTCATTTTAGGTAGAAACAACAGCATGCTC
TAGGTGTAGATCAATTGAAGATTAATAAAGACTGATAAAAGTATATTTGTGTTTGTATTT
TTTTGGTCTCTACAAATCTGGTCTCTTCCTGAGCTGAAGCAATCCACCTCCCAAAGTGAG
CCACCATGCCCAGCCCTTTGGAGATTTTTTTTGTGATCTACAATGAATGCTTTGCCTCAA
GCAGTAAGCCCCCAAAATTGCTCTAGCACAAAACTAGAATCAGATACAGCTTTTATCATA
AGCCCCAGAGGGGCCAGCAAGTATGGGTGCTTCCCCATTCTCCAAAGTTCACATGGAGGA
GCTGCCTTCTCCCATATTTTAACTTTCTGAGCGGCTTATCTCCCATATTGATCCTAAAGT
GATCCAGCCAGGCCTTGTATATGCAGATACTGAATATACAAAAAAAGATGAAAATAAGAT
GAAACCCATTCTTGTGAGCATTCTTAGGCCAACTGGCCTGCTCTATCACCCCACCACATC
CTACCTCCTGACTCTAAAGCTGACTCTAAAGTTAGACAGCAGGTACTATAAATACTCCAG
AGAGCCTTGATTTACATAACTGAGAAGCCGATAACCCAGGCTTTAGTGTGTGGATCATCC
CAAGCTGCTCATCCCAGTTTCGGGTAACCCCAAACTATCCTGTGTCCAGGAGTGGATAAC
TGCCTGGACAAAGGATTCCTGTGAAGGAAAGCAATTTGAACCTTGTTTAAAAGTTGTTCC
CGTGGTCTTCAAACTCAAACGGTCAAATGAATGCAGCAGTGTTGTAGAAATACTCATGAT
CTCCAGAAAGTCATTAAAATCTTACAAATCGTATTTCCAAAAAGGTTTCACATTTCTTTT
TTTTTTTTAAAAGGAGTCTCTAATCTCCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved