Macaca_mulatta Locus Poly:14:SNORA70
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:14:SNORA70
Macaca_mulatta
Poly:14:SNORA70
13
SNORA70, SNORA70
1001..1133, 1332..1453
2453
GTATGGTAGGCCAGGTGTGGTTGCTTCTGTGTGTAATCCCAGCACTTTGAGAGGCCAAC
ATGAGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGTGAAACCCC
ATCTCTAATAAAAATACAAAATTAGCCAGGGGTGGTGGTGTGTACCAGTAATCCCAGCTA
CTCAGGAGGCTGAGGCATCAGAATCATTTGAACCCAGAGACGGAGGTTGCAGTGAGCTGA
GATTTGTGCCACTGCATTCCAGCCTGGGCAGTAGAGTGAGACTCCATCTTAAAAAAAAAA
AAAAAAAAAAAAAGTATGTTAACAATAATTCAATATTTACAAGCATTGTAAAGATTTTTG
GCCCAGGGTAATGGCTCATGCCTGTAATCCCAGCACTTCGGGAGGCCCAGGGAGGTGGAT
CACTTGAGTTCAGGAGTTCAAGACCAGCCTGATCAACATGATGAAACCCCGTCTCTACTG
AAAATACAAAAATTAGCCAGGTGTGGTGGTGCTCATGTGTAACCCCAGCTACTCGGGAGC
CTGAGGCAGGAGAATCATTTGAACTTGGGAGGCAGAGGTTGCAGTGAGCTGAGATCACGC
CACTGTACTCCAGCCTGGGGGATAGAGCAAGACTATGTCGCAAAAAAGATTTTAGTATTT
TATACTATTTTTTCTCTTATTTAAATGATACAGTCATTGTAGGGAAAGAAAAGAAACTTT
GATAAACTAGAGAATCGAAGTTAAATACAAAAACATGCCACGATTCAGAGTAACAACTTG
TAACTTTTTGTGTATATCCATGGTGTGAGAGATTGCGAACAGTACAGTTTTAAATTTTAC
AAAAATGTGGTTTTACTATATGTATACTTTATGGTCTGATATTTCAGGTACAGTTAACCG
TGGTCAGTCTCTGTGATCAAGTGTTATCTGTGTCATCATTTTTAAGTGCTGTTTAACAGT
CATATAGCTGTCTCTACTTTGGCTATAACATGACGGAGGTCCTGCAGCCAATTAAGCCAA
CTGAGTTCCCTTCCTTATGGGGGCCCCAGTGTGCAGTCGCTGCAAACAGCAGCTTCCGGC
CGGGCGCGGTGGCTCAAGCCTGTAATCCTAGCACTTTGGGAGGCTGAGACGGGCGGATCA
CAAGGTCAGCAGATCGAGACCATCCTGGTTAACACGGTGAAACCCTGTCTCTACTAAAAA
ATACAAAAAACTAGCCGGGCGAGGTGGCAGGCACCTGTAGTCCCAGCTACTCGGGAGGCT
GAGCCAGGAGAATGGCGTAAACCCGGGAGGCGGAGCTTGCAGTGAGCTGAGATCTGGCCA
CTGCACTCCAGCCTGGGCGACAGAGCTAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAA
AAACGGCAGCTTCCTTGGTAGTATATGCAGCCTGTTTGTTGTATGGGTTGCTCTAAGGGA
CCTTGGAGACAGGCCTTTCAGATGTATGTTCATGTTTCTGACCTTGCGCTATCCCAATGT
AGGCTCCAAACAGGCATGCGAGGTGCCTTTGCAAAGCCCCAGGGCACTGTGTCCAGGGTT
CATGCTGGCCAAGTTATGTCCACCTGCACTAAGCTGCAGAACAAGGAGCATGTGATTGAG
ACCCTGCGCAGGGCCAAGTTCAGGTTCCCCAGCTGGAAAATCCACATCTCAAAGAAGTGG
GGCTTCACCAAGTTCAATGCCGATGAATTTGAAGACATGGTGGCTGAGAAGCCGCTCATC
CTAGATGGCTGTGGGTTCAAGTACATCCCCAGTCATGGCCCTCTGGACAAGTGGCTGGCC
CTGCACTCATGAGGGCTTCCACTGTGCTGCGGCCTCTTAATACTCACCAATACATTCTAC
TTGCTGTCCCCCCCCCCCCAAAAAAAAAAAGATTAGGGAGGTTAATAACACATGTTTGTT
TACCAGATTATCATCATTTTGTTAATTTAATGATTGGGAATGGAATAGGAGGAAAACTAA
CTCAGAAAATGGGAAGAGAAAGGAATAGGAGAATAAATTGAAGACTAAATTAGGGAAAGG
GCATATACACATCTGCAAAGGAATATCATGTATGACAGAAGCTCCGCTACCACAGAGCAT
AATTCCTCATGTTGTAAGTGTTGTTGTTGTTGTTGTTGTTGTTGTTTTGCTTGTTTTAAG
CTTACTACAAAATGGAGTTAGGTTTATATCTTGGAAATTCCATATTCCTTAGCAGGTATT
TAAAGCTCTTTATTATCTCCTACCTATCAACTCTTTAACTTTATTTCAGGAATTTCTTCT
GTATAAGAACTCTGGATGCCAGCCAGGGTGAAGTTCTCTGTCAGGTTTCCAGGCTAAAAG
TAGTACATTTTATACTTGTCATTTGTGCTTAGTCTTTGAAGCTTTTATTTTTATGTTTTC
ATTGTTTTAATAAATTTTATTTTTTAGAATAGTTTTAGAAGCCATTGCTTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved