Macaca_mulatta Locus Mono:163:SNORD81
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:163:SNORD81
Macaca_mulatta
Mono:163:SNORD81
11
SNORD81
1001..1075
2075
CCAAGAGGATGGAGACACATCATTTTCTTTCTTCATTTAACTCCAATAATACTTTAGAA
CTTTAAGAATATAAAGAATCTATGAAATTACAACATGGAGGTCTTCAGTTGAATAGAAGG
CACCATTTGCTGTTGGTGAGAGTTTTTAACACGGGTTAGAGAGTCCACAGGAATTTGAAA
TCCTCTTGTGAATTCTTTCGGAATATGACAGATTAGTTTTTTCCAATTGGCTAGTTACCC
AGTTGTAATATCTCCAAATCCATTCCCATCCTCTTCGAATTATTCTAGCTCAATTTGCTG
TTAGGCAAAGTTTGTCAATTTCTCCAAAAAGTGAGTTTTCAGCTTCGGGGAGGATTAGTT
GGAGAATAATTCTTCCTATTTCTTATGTCTTGTGCTGAGAGGAAATGTTGTCTGTCCTTC
ACATACATTGAAATCCAGCACAATCAAAAGAAACATTGGCAAGTGGTTTGTTTCTCAATA
CTTCTTGTACATTTTTTGGGGGGGGTTGTATCTCATAATTACAATTCTCTTATTGCTCTC
TAATTTTTTTCCCCAGTCCATAGATAAACTGAGATAAAAAAAATCAGCCAGGGATTAGGG
AACATCATGCAACTCGTGACACTGTGCAGAAGATCCAGTGACTCAACCAAAATAAGAGAT
AACCTGGATCCACACACTGTTTTCCTTACATTCAGCTGCCAATATAAAATGATTTGCACA
TTTTTTCAAAATGATGCTTAATTCAAAATAGGAGTTCATATAAGTTCGAATGTAGGCTTC
CTTTTTGTGAAGGACAGATGCAATCATTCAATGTCCAACTTGGATCCCTATCTTTCATCT
TATCTGATTCTGTTGTTCTTAGGGATAGCTGTCCTTGTTTACAGTCATGATGAATATTTC
CTTGGGGGATACTTGTTCTAATGGCAATGGGAAAAAAAAAAGCAAAATGGACGGGAGAGG
AGAAACTGAACTTTTTTTTTTTCTTTACCAGAAAGTTATGAGCAGATAAAATAGGCCTTT
AGAACTATTATCCAGGAATCACTGATTACTTGATGACAATAAAATATCTGATATCCCATG
TTCCTCAAGTATCATTTAAATTGAAATCTGGAAATGTTAAGAGTGGTCTTTGTTGTAGGC
AGCTTGATGGATGCTTATGGGATAGAAGATTAAACACGTCTTTCAATTTTAATAAATTTC
TTCAAACCAGAAAAAAAAAGCTATTACCCATTAAAGTGGGAGAAAGTGAAAGTGACAGAA
GTGGGATTCAGGGTCTAGTGAAAACCAGTCTAAAAGCCATAAAATCACAAATCAAGTGGT
CATTGAAAATAGACAGAAGGTGCTTTATTATGCATGAATCAAACTTATAGTTATTTTCTA
AAACTAAGAGGGAAAGAGAGATTTGGAGTTTGAGATAAGACTTTGCCATTTACTTAGCGA
GTTATTTAACCTCTTTGTGTTGAATTTCGTTATGGGTAAAATGAAGGTGATAAAAGTATC
TATTCATAGGGTTGATGAAAGGATTGAATGCAGTAATGTACATAAACACTTAGTGTGTTG
CTCTGAGCCTAGTAAGAGCTTAATAGATATTAGCCATTATTACACTTAAAAAGTATTTAG
TTAAGAAGGAACTATAGATGTAAACGAAATGCAAAATATCTGTAATGACCCGTCTAACAT
GTATAAAATGTAAAATGTCGAGATAGTCTCTTTATAAATTGTACTGCCTTTATAGTTTCC
TTTTAAAGAAGGTAAAAGTATTTAAAAGGTAAATATTTGTAAGATACTTATATAATAATG
ATAGAGACAGAAGACAGCCAAATGCCACCCAGGTCATACAGGGGGCTTGCCTAAACATGC
CTGCAGTGAAAAATTCCATCCCTTAACACATGTGCAGTAAAGAAAATAAGTCAAGGTGGA
ATAGCTCAGACTATAGGCCCGCATGCACACTGGAAGAAAGGGGGTGGGGCCACCAGGAGT
TCGCGCCTTATGCAGTGGGAGGAGCCAGGCCTCTTGAGCTTAAATGTGGAGCTCATGTTG
GTGGCCTGGTATTCAATCTGCGAGGTGGGATCCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved