Macaca_mulatta Locus Mono:137:SNORA18
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:137:SNORA18
Macaca_mulatta
Mono:137:SNORA18
2
SNORA18
1001..1133
2133
TCTGAAGAAAACACCAGCTGTGGAAACTTGTCCAAGTCATTTAACCTCTCTAAGCCTCA
GTTTTCTCATTCCTCAAGATCCTCACAAAAACAGTACTCAGATTAAATGAGGTAACAAAC
GTTCATACCCTAGTGTTTATATAGGAAGGCACTGACTTCCATGTGAGGTGACTGAAGCCT
AGTAAACAAGCTTCTTGGTTTCTTTACTTAAAAAGTCCCTGATCGTAAAAATATCAACAA
ACATGTAATTTAGAAAGCAAAGAACATCTCTGCTATCCTTGGCAGCTGCAAAGAAAGTCA
AAAGGAATATATTATTCAACGTAGTCTAACTTCTCTAACAAACAACTCCCCAGTTGCAGC
AGCTTGACATAGTGAAATTGTTATTTCTTGCTCATGTCACAGTGCAGTGTGGGATGATGG
AGGGACTCTGTTCCACATTCATTCATGAACCCGGGCACCTTCAATCTTGTGGCTCCACCC
TCATATTGGCCCTTAAAGTTCTTTCTTTTAAGGTAGCTAATGAGAAAGAAAGGCAGAAAA
GAGAACCTGATGACCACACAAAGGAAGTGTACGTAGGTCATTTCTGCAAGTGGCGTGTGT
TGCTCCAGCTCACACCAATTGGCCAGAATGCCACTGCATAACCTTACCTGGAACATGTAG
TGTCGCCCTGTGCCCAGGGAGACAAAAACAACAATGTTGGTGAACTTGGGCATACATTCC
TGTCTCAAGAGCCATAAAGACCTGTTAGATTAGTTCTTTCAGATTTGTTTGTTCTTAACT
GTTTACTCTCCATTACTCATGCATATCCTTTGATCTATGTTCAGGCCTTTGATTTTATGT
AAATGCTTAGGCGTACACATTTTCCTATAAGCAGAACTTAATAATGAGAAAAGAGGTAGA
CCAGAAGTGCCTTAGTGTCTAAAGTAGAAACAAAAAGATAGCTGTTAAGACAGAAGATAA
AAAATAGGGAGTCTCAGAGTGCAAAAGGAAGTGATACATTTTTTGAGGTCTATCCCGATG
GGACTTTTCCTGGAGGCTGCACGTTGTTGGAAATGCCTCATAGAGTTAACTCTGTGGTTT
TACTTTCTTCACAGGACTCTTGTTAGATCTGTGGGAAGGAACTACAAGACAGTTGCTATA
AGTATGAAAAAGACAGTTACTAAATGTATGAAAGACCTGGTAATTTACTTTTTTACCTTG
GGTATTGGCATATTCCATATTCTGCAATATTCTTGAGTGTGATCGCTTAGGAATGAATAT
GATTTGAACTCACTCAGGTTTAGAGAGGTGTCAAATTGAGAACTAGGCAGATCCACCTAC
ACTAAAAAATGACCCTAAAGTAAATTGGTTGAAGAAATTAGATCTTAAAGATTCCTGATT
TTTCCAAAGGTAAATTTTGAAGTCTTCATCAGTATATCCATATTAAAAGGAGATGACAGA
AGCCAAAATCAAAGAGTTATGGCCTGACAGGACAACTGCATTAAAATAAGCATCAGTTTC
ATTCAAAAGGACTAACTTGAAGATAAATCTTTTGAAGATAAATTTTGACTGCAGCTCTTT
AGAGGATCTAAAGTGACCTTGATGGACAGTGGAAGAAACTGCAACATGGAATTACTTGAA
TAAAAATCTATTGACTTTAAATAATTTCGCCTAATGTTACATATACACAGTTAAAACGAA
AACACCTCTTTACACTGTTAAAAAAAGAAAAAGAAAAAGAAAATAATAGATTTTCACATT
GCCCCACTGATGCCATCAAAAGTCTATATAATCACTAGAGTCAAGTATTAGAAATGCTAT
CTTCTGTGGCCACATTCCCTTGCAAGGCCCATTAGTCCCTAAGTTGTCTCCCTGGGCACA
TGGCAACACTACATGTTCCAGGTAAGGCTATGTGTTGAGAAACAGTAGTGCTGGCTAAAG
CCTCACAGAACATCTGGTGAAATTAATCTATTTGCAGGCTGCAAATGCCTATAGCAGTTG
ATGACCGCGATGAAAAATGCTTTCACTTTCATGGACTATTTCAAACTTCCAAGAGAAGTT
AAGGTGAGACAGACTCCCTAGTTCCCCATCTCTTTTCCTTTCTTCTGGTTCCTATCCACA
TTCCGTACCCTGAAAAAGCCCAGATCTTCTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved