Macaca_mulatta Locus Mono:181:SNORD66
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:181:SNORD66
Macaca_mulatta
Mono:181:SNORD66
13
SNORD66
1001..1081
2081
TTTTGTTACTGTTATTGGATATAGATTAGACCATCTGAAGTTGTCCCACAGTTCTTTGA
TGTTCTGTTAAATTGTCTTTCAGTGTTTTTACCATACGTGTTTTATTTTGGATTATTTTT
TGTTGCTCTGGCTTCAAGTTTCCTAATTTTTTCTTCTGTAATGTCTAATCTGCTGCTAAT
CCCTTCCTTGGTATTTTTCATTACAGATATTGGTTTTTGTTTCCTCTAGAATTACAGTTT
AGGTCATTTTCCTTGTCTCTCCTTCATATGCTCATGCTTTCCTCTATCTTCTTGATCATA
TGAGATATATTTACAAATATATTTACAATATATTTACATATAGATATAATTGTTTTTATA
TCCTTGTCTACTAATTCTACCCTCTATGACATTTCTGGATCTGTTTCAATTGACTGATCT
TTTTCCTCCACATTATGCATAGTATGTCTCATAATTTTTTATCAAATGCCAGATATTGTG
AATTTCACTCTGCTGGGTGCTGGATGTTCTTGCATTCCTTCAAATATTACTGAGGTTTGT
TATGAGATGTAGCTATGTTACGTAAAAACAGTTTGATCCTTTTGAGGCTTCTTTTTGAAC
TTTGTTGACTGGGGCAAGCAGCTTTTACAATAGGGCTAACTTTACCATGCTATTGAGGTA
ATTAGTCTAGGGCTTGTTTTTCCCTTCAGAGGACTCTACCCAATGCACCCTGAGTTATGA
TGTTTTTCACTCTGCCTGGTATAACCATCGACTATTCCTAGCCTTCTGTGAGCTCTGCTG
ACTACATTCCATTGAGACAGTTATTTTTCTAGCTTTGAGTAGTTTACTTGCATACTCTGA
TCAGTATTTAGCTGACGACAAGGTGAATCTTTTCCAGATTCTAGAACTTTCTCTTTGTGC
AACTCTTTCCCCTGTACCACTGTGTGTGGGAACTCAAGGTGCCTTATACTTCCCAATCTC
TCAACTCTATTCAATTGAGAGAGACCTCCAGGTCTTACCTGAGTTCCTGCATCCTGCACT
GTGGCCTGAAAACTCTCTCAAGAAAGTAAGTTGCTCTATGATGGAACTGAGGATCTGAGG
AAGGGAGGAAAAAAAATAAAAAGAAAGTAAGCTGGGGCAATAATAGGGCTCACTTTATTT
GCTTCGCCTTTCTTAGGGATCACTGACCTGCCCCACTTGATGTCGTGTCTGAAACCCATT
GTTTCATATATTTTGTCTAGGTTTTTTGTTTCTTTGTTGTTTCAAACAGGAAGATAAATC
TGGTTCCTGACGCTATCTTTCTGAAACAGTATCAGGAACTGATAGAAGTCCACCAAAAGT
GCAATTCATCTCAGTGGAGGAAAAGATAAATTATTATAAATGGTGTCAGTACACATATTA
ATAGGTTCTAATTTGCAATTACAGGATAAAATATGAGACAGTTTTAACAGAAAAGAAGTA
TATTAAATATTATTAATAGATTACAAATTTTCCAGATGGGCCAGAGAGTTAGACTTTGAG
GTGAAGCATCTGGAAACTGAATTAACCTGTCCAACTATTCAAAGGAATGACTGCTGATGG
GTGCTGACGAGTTGATGGGTGCAGCACACCAACATGGCACAAGTTTACATATGTAACAAA
CCTGCACGTTATGCACATGTACCCTAGAACTTAAAGTATAATAATAATAATAATAATAAT
AATAATAATAAACAAAGGAATGACTGCAACATTCTGGTACTGGCAACATACTTCACACCA
TAGTTGTGCTGTTGCTATTGCTGTTGCTAACTTCTCCATATTTTTCTGCTGTGCTTCATC
ACTCTCTTCAGGAACTATGTTTGGTAGTACCTGCCTTCTCATGATGTTCTTTCCAAATTC
AAGATTTCCTGAATGCATATCTAGTTGATGAAACCTAGGTCATGCACCTTCTTCAGAGCC
ACGAGAGAAGCCGGGGACTTGACTTTGGATCTTCCTTACAGTTTGAGAACATCCCCAAGT
ACAGAAATATGATTCAAATGACACTAGGTGGCTACAAATAGGTCAAATAGTCCCACAGCA
CAAACTGAGTAGTCATGTGAAAACAGGTGAAGTTGAATCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved