Macaca_mulatta Locus Mono:112:SNORA71
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:112:SNORA71
Macaca_mulatta
Mono:112:SNORA71
9
SNORA71
1001..1118
2118
CTGGAGTACTGTGTGGTCTCGAACAAGTGCCCTTTTCTCTCTGTGATCCCATTTTTCTA
TTTGTAAAATTAGGGGATTGGACAAATCCGTCAGTTTCCAAACTCTGATTCGTGGAACCC
TGGGGCTCACTGGCAGGGATGGGGAGAGGAAAGCGGGTAGGCAGGGGTGAGACCCACCTC
CTTTACCCCAACCACAGTGGCTTTTCTTTCATTGGTCCTACATTCAGTTTTCTAAGGAAG
GTTATACATGAAGAACAATTTTCTGCTACCAGAAGCACTGGACCACAACTGGGCTCCAAG
ATCACTTAGAGTCTCTCGTGTTTGTATGGTAAAGGTACTAGGTTCGGAAAACCAGATTTT
GCTACGTCCTTTAACAAGTGTCTGTTTCATAACTAGCTTTATTGTGCTGAATTTGATATC
TCCAGAAAAACAGTCGCATCTGTGCAGACAGGGAGAGCGACTTGAGGGAGTGTGAGGATG
CCACGGAGTCAGACGCAGAGGGGCAAGAATGGCTCTTGCAAAGCAGTGACCAGGGGCCAA
CTGCCCACAGCCCACCTCCCCAGGCCCACTGGGGCTCCAAGTCATTGGGAATGCCCCAGG
CAGGGGGGATGGCTGTCCTCCCTGTGTTGAACCAGCAGAGCTGTTTTCTTCTGGGTCCTC
CGCCCTCCTTGGCTGTCATCTCTGAGCGGGGTACGCAGCCCTCCGGCTCCGATCCACATG
GAGGCTGGTCATCCATCTCCTTCTGGCATCCGTCAACTGCCTGAGCTGTCGGTGGAGGCT
GCTGCAGCCTCTCTGTTGCTGACCTCTTGCTCCCCAGCCTCTTGAAAACTCCCTGTGATT
TGTCTCTGGTCCTCCTGCAGTCGCTCTGTCTTCCCCTGGGGTCGGGGGTCTCAGGCTCTC
AAGACTGTAAGGCTCACTGTATCCGCTGCCTCATTCGCCAGGCGCTTCAAGCTCCAAGGC
TCCCCTTCTTCCTCACCTTTGGGTCTTTGAAAATTTTGCGCCCCTATATTCTGAAGTGAT
CCTGGTCATTGACAGTCCAGGGAGAGAAGCTGCTGAAAGCATTTCCCCTTGTTTGGAGGG
TCCACTGCTGTCCCTTCTAAACTCTGGAGTTTTTCCACACCTCCTCCTTTTCATCACCTT
TTAGATGCCTCCTGATACCTGGAGTCTGGCTTATGGAGTGCTCCCTGTGTGAGGTTCAGT
GCTGGTGTCTGTGAGTCTTCAACCAAGGTATACATTAAAAAAAAAAAGAAAGAAAGAAAG
AAAGAAAGAAAGAAAGAAAGAAAGAGAAAGAAAGAAAAGAAATGTTTTTTCTGTCTGACC
TTCTATTTGTGTCAGCCCAGGCCTGGGGAAAGGTGAGGGCAGGCCTGGTGGCTTTTCCAA
TCTGGTCATCCCCGAATCTCAGAAACACCACTCCCCTAGTGCTCCCTGCACACCCAGGCT
ATGCTGGCCAGATGTGTCTCTCTGGTCTCTGTTGGACTCCAGCCCAGCCTATTCTCCTTG
GCAGCAGCTCCTGGCCTGCTCTGCAGAAGGGGCAGCTATTTCAAGCCAGGCTGAGGGCCC
TGGATGTGACCTTTTAAAGAAAAGATGATGGTAGCTCTCTTCCCAGGCAGCACCACCGCG
GTCCCACAGAGCACCTGGCAGCCCCCTTCTGAGTCCACACATTGCCTGCAAGGATTGCTG
GTTTTCAGTTCCTTCTCAAAACTTTGCCTTGGGACAGTGGCTGAGTCGGAGGCTAAGGCT
CTCTTGGGGTATCCTTTGCCCAAGTGCAGTTCCTCCCACTGAGCCACAGTGTAATCTCTG
AAAGAGTCTGCCCAGGCTGGGGCTGCCGGGTCACCTATTTATTTTAATAGTGCAATCCCT
TTTGGGATGACTGTAAGCAGAGGCCCCAGGGAAAGACATCTGAAAACAAGTTGCTTGGAA
GCAAGCCTCTTGGAGGACCATAGTGGGGTGGATTCTGGAGTCTTTCTTATCGTGCACCCA
TGCCTCCCCCACTCCCACTCACATTGGCCTAGTCCATGACCCTCCCTTCCTTCTTGAGGA
GATCAGCCTTCTAGACTCCTGGAGGCCCCAGCATGGGACATGCCACAGGTGACCCTAGAA
GCCAGGTCTCTGATTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved