Macaca_mulatta Locus Mono:20:SNORD115
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:20:SNORD115
Macaca_mulatta
Mono:20:SNORD115
1099214098082
SNORD115
1001..1081
1111
AGTCCAGCCCTTGGACTCATGGGCTTTGGGCCAAGGGTGCAGCCCGCATCCCGCTGGAA
GTCACCCCTTCCCTGTGGCTCGAAGTTATCCCTTCCCAGTGGGCTAATGTCAGGAAGGGT
GGCCTCCTGGAGTGGGAAGGCCCGCTGTTGAGGGTCTGGTCCTGGAAATTTGCTGCCCAT
GCTGCTTCTGAGCCATGGAGTCACCAGTGTGGTGGGGTCCTGGGCCCGAGGAAAGGAGAA
GACACTGTTCTCCCTGATTAGTCCGGTGTGGCCAGGCTGTGTGTTTGTGAGGTGTGAGGG
CATGGATGGAGACTCACCAGAGAAAGCACATGGCCCTGGGACCCCAGGTTGTGATTTCCA
GTACATGCTTGGATACAGCACGTGGGTGGGTGCCCACCATGCACAGGGACTGGCTATGTG
ACTGCCAGCTCTGCAGCAGCATCAGGCATCCGGGCCAGCCTATTTGGTTGACCATGAACT
GGTTGGTGGCCCTGGCCTGTGCCCGGTAGTCCTGGAGTGACCCTGGTGTCATGCAGGGGA
GCTGGCATGTGTAGTGGAGGTGTTTGTGTGGCCTGCAGTAGGATGCAGCCCTGGCTTGTA
GCCTGAGCCCAGTGACCTACCTGTCCTGTCGTTTCAGGGTTCAGTGGTGGAGACAGCATT
GGGTGCCCTGCGTCTGTGACGGGCCAGTATTCCACATGGATCTCATCACATGGTCCATGG
AAGGCGAGCATCCCTGAGCTGGCACACCCCACCTTCTGCCCACATGGAGGGGTGAGGTTG
TGTTTGGACACCTGTCCTCTTCCTGTTCCTCGAGATGGTGACCCCAGATGAGGATTCGTG
TTGGGCCCACTGTCCCCGGGCCAGGGTCCATCAGCCAGGTGCCTAGCCCCTGTTGCACTG
AAGCTCTGGCCCTTCCTGTCACCTTGGTCTCCTGCATTGAGCTTGGGTGAGCCCATCGGG
GTGCCACTGGATGCCTAAGCAGGGAGGGGGTGCCCTGGGTTGGGTCGATGATGAGAACCT
TATATTGTTCTGAAGAGAGGTGATGACTTAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAGCCTAGATGAGAATTTTGGAAGAGGATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved